Πληροφορίες

Πώς μπορεί κάποιος να μοιράζεται το 50% του DNA του με τους γονείς του, ενώ όλοι οι άνθρωποι μοιράζονται το 99,9%;

Πώς μπορεί κάποιος να μοιράζεται το 50% του DNA του με τους γονείς του, ενώ όλοι οι άνθρωποι μοιράζονται το 99,9%;


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Έχω ακούσει ότι οι άνθρωποι μοιράζονται το 99,9% του DNA τους με άλλους ανθρώπους. Έχω ακούσει επίσης ότι ένα παιδί μοιράζεται το 50% του DNA του με τους γονείς του. Πώς μπορώ να επιλύσω αυτή τη φαινομενική αντίφαση; Πραγματικά με έχει ενοχλήσει.


Θα γίνει σαφές με μια απλή αναλογική.

Είστε 50% συγγενείς με οποιονδήποτε από τους γονείς σας

Ας πούμε ότι δεν έχετε βιβλία βιολογίας. Έχεις δύο φίλους, την Αλίκη και τον Μπομπ. Ο καθένας σας δίνει ένα αντίγραφο του βιβλίου Campbell Biology. Τώρα έχετε δύο Campbell Biology. Έχετε λάβει το 50% των βιβλίων βιολογίας Campbell από την Alice και το 50% από τον Bob.

Ομοίως, κληρονομείτε το 50% του DNA σας από τη μητέρα σας και το 50% από τον πατέρα σας. Είστε συγγενείς κατά 50% με οποιοδήποτε από αυτά.

Δύο άτομα που έλαβαν τυχαία δείγματα είναι 99,9% πανομοιότυπα

Τώρα σκεφτείτε τη λίστα με όλα τα αντίγραφα του Campbell Biology στον κόσμο. Καθώς υπάρχουν διαφορετικές εκδόσεις, όλο το Campbell Biology δεν θα είναι ακριβώς το ίδιο. Ας υποθέσουμε ότι παίρνετε τυχαία δείγματα δύο βιολογίας Campbell από όλο τον κόσμο και τα ευθυγραμμίζετε γράμμα προς γράμμα. Ποιο είναι το αναμενόμενο κλάσμα των γραμμάτων που θα είναι πανομοιότυπα; Αν, για παράδειγμα, βρείτε τις δύο προτάσεις

Η επιλογή είναι μια διακύμανση καταλληλότητας που σχετίζεται με μια γενετική διακύμανση μεταξύ ατόμων σε έναν πληθυσμό.

και

Το Zelection είναι μια παραλλαγή fitnezz azzociated σε μια γενετική παραλλαγή μεταξύ των ατόμων σε έναν πληθυσμό.

Υπάρχουν ακριβώς 9 αναντιστοιχίες από τους 99 χαρακτήρες, δηλαδή μια παρομοίωση κατά 90%.

Ομοίως, εάν δειγματίσετε τυχαία δύο ανθρώπους, ευθυγραμμίστε το DNA τους (μια αλληλουχία DNA μοιάζει μεATTTCGCTGTCGAATCGATCGGTA), θα διαπιστώσετε ότι το κλάσμα της αναντιστοιχίας είναι χαμηλότερο από 0,1%. Επομένως, όλοι μοιραζόμαστε το 99,9% του DNA μας.

Φυσικά, η ευθυγράμμιση αλληλουχιών DNA (ή κανονικών προτάσεων) δεν είναι τόσο εύκολη, καθώς ορισμένες ακολουθίες (ή προτάσεις) μπορεί να έχουν περισσότερα νουκλεοτίδια (ή γράμματα) από άλλες, αλλά δεν θα μπω σε λεπτομέρειες εδώ.

Πώς συνδέονται αυτά τα δύο μέτρα;

Ας πούμε ότι αντί να σας δώσει ένα βιβλίο, η Αλίκη δημιούργησε ένα αντίγραφο του βιβλίου της και σας το έδωσε. Το βιβλίο που λάβατε από την Alice (δηλαδή το 50% όλων των βιβλίων Campbell Biology) είναι 100% πανομοιότυπο με το βιβλίο της Alice όσον αφορά την αναντιστοιχία.

Ομοίως, το 50% του DNA σας που κληρονομείτε από τον πατέρα (ή τη μητέρα σας) είναι 100% πανομοιότυπο με το αντίγραφο του γονιδιώματος που βρίσκεται στη μητέρα σας.

Σημειώστε ωστόσο ότι

  1. Η μητέρα σας πιθανώς έκανε μεταξύ 10 και 100 μεταλλάξεις κατά την αντιγραφή του DNA της, έτσι ώστε το DNA που λάβατε από τη μητέρα σας να μην είναι ακριβώς 100% πανομοιότυπο με το DNA της μητέρας σας

    • Παρομοίως, η Αλίκη θα μπορούσε να είχε αντιγράψει λάθος το βιβλίο της Campbell Biology που σας παραδίδει
  2. Η μητέρα σου στην πραγματικότητα ανασυνδύασε τους δύο απλότυπους της

    • Ομοίως, η Alice είχε στην πραγματικότητα δύο διαφορετικές εκδόσεις του Campbell Biology και τις μπέρδεψε λίγο πριν αντιγράψει το βιβλίο που προέκυψε!

Το 99% και το 50% αναφέρονται σε διαφορετικές αισθήσεις συγγένειας.

Οι άνθρωποι μοιράζονται το 99% των γονιδίων με άλλους ανθρώπους: Αν συγκρίνατε έναν άνθρωπο με έναν άλλο άνθρωπο σε σχέση με κάθε ένα από τα γονίδιά τους, θα βρείτε 99% ομοιότητα.

Ένα παιδί μοιράζεται το 50% των γονιδίων του/της με τους γονείς του/της: Αυτό το 50% αναφέρεται σε μια συγγένεια σε σχέση με το ποσοστό συγγένειας του πληθυσμού. Στην πραγματικότητα αναφέρεται σε ένα γονίδιο εντός αυτού του 1% που είναι διαφορετικό (πολυμορφισμός) μεταξύ των ανθρώπων. Αυτή είναι μια προσέγγιση που χρησιμοποιείται για να υπολογιστεί ποιος βαθμός κοινωνικότητας θα μπορούσε να επιλεγεί για να μεταδώσει ένα άτομο σε άλλο άτομο, όπου το γονίδιο για την κοινωνικότητα θα είχε κάποια συχνότητα μεταξύ 0 και 1 (δηλαδή, θα υπήρχε κάποια διαφορά μεταξύ των ατόμων στο τόπος όπου βρίσκεται το γονίδιο). Για αυτόν τον υπολογισμό χρησιμοποιείται ο κανόνας του Hamilton (1964). Είναι c < b*r, όπου c είναι το κόστος του ηθοποιού. β είναι το όφελος για τον αποδέκτη της πράξης. και r είναι η σχέση μεταξύ του ηθοποιού και του αποδέκτη. Το r που χρησιμοποιείται σε αυτόν τον κανόνα μεταξύ γονέα και απογόνων είναι 0,5. Η ερμηνεία είναι ότι εάν ένα γονίδιο είναι υπεύθυνο για ένα κόστος (γ) για τον κάτοχο του γονιδίου (έναν γονέα) και ένα όφελος για κάποιο άλλο άτομο (έναν απόγονο), η συγγένεια (r) μεταξύ του κατόχου και του άλλου ατόμου πρέπει να να είναι μεγαλύτερη από c/b επειδή η συγγένεια δίνει την πιθανότητα ότι ένα αντίγραφο του γονιδίου που ευθύνεται για το κόστος και το όφελος βρίσκεται επίσης στο ωφελούμενο άτομο και έτσι η πιθανότητα ότι ο απόγονος μοιράζεται ένα ευνοϊκό γονίδιο που φέρει ένας γονέας είναι η μισή διαφορά μεταξύ 1 και το ρυθμό φόντου. Εάν το γονίδιο είναι σε συχνότητα 70% στον πληθυσμό και ο ένας γονέας έχει το γονίδιο, τότε η πιθανότητα του απόγονου να έχει το γονίδιο είναι 85% (υποθέτοντας ότι ο άλλος γονέας το έχει με πιθανότητα 70%).


Είναι τα δακτυλικά αποτυπώματα κάποιου παρόμοια με εκείνα των γονιών του κατά οποιονδήποτε διακριτό τρόπο;

Ναι, υπάρχει μια κληρονομική ποιότητα στα δακτυλικά αποτυπώματα. Οι τύποι προτύπων συχνά κληρονομούνται γενετικά, αλλά οι μεμονωμένες λεπτομέρειες που κάνουν ένα δακτυλικό αποτύπωμα μοναδικό δεν είναι. Οι άνθρωποι, καθώς και οι πίθηκοι και οι πίθηκοι, έχουν το λεγόμενο δέρμα ραβδώσεων τριβής (FRS) που καλύπτει τις επιφάνειες των χεριών και των ποδιών τους. Το FRS περιλαμβάνει μια σειρά από ραβδώσεις και αυλάκια που παρέχουν τριβή για να βοηθήσουν στη σύλληψη και να αποτρέψουν την ολίσθηση. Το FRS είναι μοναδικό και μόνιμο -- κανένα άτομο (συμπεριλαμβανομένων των πανομοιότυπων διδύμων) δεν έχει την ίδια ακριβώς διάταξη FRS. Επιπλέον, η διάταξη των κορυφογραμμών και των χαρακτηριστικών δεν αλλάζει σε όλη τη διάρκεια της ζωής μας, με εξαίρεση τη σημαντική βλάβη που δημιουργεί μια μόνιμη ουλή. Ο όρος δακτυλικά αποτυπώματα αναφέρεται στο FRS στα άκρα των δακτύλων μας.

Τα δακτυλικά αποτυπώματα έχουν μια γενική ροή προς τις κορυφογραμμές που μεταφράζεται σε έναν από τους τρεις κύριους τύπους μοτίβων: στρόβιλο, βρόχο ή καμάρα. Είναι δυνατό να έχετε μόνο έναν, δύο ή και τους τρεις τύπους μοτίβων ανάμεσα στα 10 δακτυλικά σας αποτυπώματα. Το σημαντικό πράγμα που πρέπει να θυμάστε σχετικά με τους τύπους μοτίβων είναι ότι ένα άτομο δεν μπορεί να αναγνωριστεί από τα δακτυλικά αποτυπώματα μόνο ανά τύπο σχεδίου. Για να κάνει μια αναγνώριση, ένας εξεταστής πρέπει να κοιτάξει στο επόμενο επίπεδο λεπτομέρειας: τη συγκεκριμένη διαδρομή των κορυφογραμμών και τα σπασίματα ή τις διχάλες στις κορυφογραμμές, γνωστά ως μικρολεπτομέρειες. Άλλα χαρακτηριστικά αναγνώρισης, όπως πτυχές, αρχικές ράχες (αναδυόμενες ράχες που βρίσκονται στα αυλάκια) και τα σχήματα των άκρων της κορυφογραμμής είναι επίσης χρήσιμα για σκοπούς αναγνώρισης.

Οι πρώτοι πρωτοπόροι στον τομέα των δερματογλυφικών (η μελέτη των μοτίβων FRS) κατέδειξαν μια ισχυρή συσχέτιση μεταξύ της κληρονομικότητας του σχεδίου δακτυλικών αποτυπωμάτων και του συνολικού μεγέθους, σχήματος και απόστασης των κορυφογραμμών. Τα χαρακτηριστικά αναγνώρισης κορυφογραμμών, ωστόσο, δεν είναι κληρονομήσιμα, κάτι που κάνει κάθε δακτυλικό αποτύπωμα μοναδικό.

Γιατί κληρονομούνται τα μοτίβα, αλλά όχι τα αναγνωριστικά χαρακτηριστικά κορυφογραμμής; Ο λόγος έγκειται στο χρονοδιάγραμμα της εμβρυϊκής ανάπτυξης: δύο κρίσιμα γεγονότα στο σχηματισμό του FRS συγκρούονται κατά τη διάρκεια των εβδομάδων 10 έως 15. Τα έμβρυα αναπτύσσουν λεία βλαστάρια--ανυψωμένα μαξιλάρια στα δάχτυλα, τις παλάμες και τα πόδια--λόγω του διογκωμένου μεσεγχυματικού ιστού, που είναι πρόδρομος των αιμοφόρων αγγείων και των συνδετικών ιστών. Γύρω στη 10η εβδομάδα, οι βλαστοί σταματούν να μεγαλώνουν αλλά το χέρι συνεχίζει να μεγαλώνει. Ως αποτέλεσμα, τις επόμενες εβδομάδες, το βλαστάρι απορροφάται ξανά στο χέρι. Κατά τη διάρκεια αυτού του κρίσιμου σταδίου, αρχίζουν να εμφανίζονται τα πρώτα σημάδια ραβδώσεων στο δέρμα των μαξιλαριών.

Η απόσταση και η διάταξη αυτών των πρώιμων κορυφογραμμών (γνωστές ως πρωτεύουσες κορυφογραμμές) είναι μια τυχαία διαδικασία, αλλά υπαγορεύεται από τη συνολική γεωμετρία και την τοπογραφία του βολαρικού μαξιλαριού. Εάν οι πρωτεύουσες ραβδώσεις εμφανίζονται ενώ το βλαστάρι είναι ακόμα αρκετά έντονο (ένα χαρακτηριστικό που περιγράφεται ως μαξιλαράκι υψηλής βολτότητας), τότε το άτομο θα αναπτύξει ένα μοτίβο στροβιλισμού. Εάν οι πρωτεύουσες ραβδώσεις εμφανίζονται ενώ το βλαστάρι είναι λιγότερο έντονο (με το όνομα ενδιάμεσο βλαστάρι), τότε το άτομο θα αναπτύξει ένα μοτίβο βρόχου. Τέλος, εάν οι πρωτεύουσες ράχες εμφανιστούν ενώ το βλαστάρι έχει σχεδόν απορροφηθεί (το λεγόμενο μαξιλάρι χαμηλής έντασης), το άτομο θα αναπτύξει ένα μοτίβο καμάρας.

Ο χρονισμός αυτών των δύο γεγονότων (παλίνδρομος βολταϊκού επιθέματος και εμφάνιση πρωτογενούς κορυφογραμμής) συνδέεται γενετικά: ο τύπος του προτύπου επηρεάζεται από το γενετικό χρονισμό (που κληρονομήθηκε από τη μητέρα και τον πατέρα σας). Ωστόσο, η ακριβής διάταξη των κορυφογραμμών, των μικροσκοπικών στοιχείων και άλλων χαρακτηριστικών ταυτοποίησης είναι τυχαίες και δεν συνδέονται γενετικά (και επομένως δεν κληρονομούνται).

Απόδειξη αυτού προέρχεται από μελέτες δακτυλικών αποτυπωμάτων από πανομοιότυπα δίδυμα. Τα πανομοιότυπα δίδυμα μοιράζονται το ίδιο DNA και, επομένως, πιθανώς τον ίδιο γενετικό χρόνο ανάπτυξης. Τα δακτυλικά αποτυπώματα των πανομοιότυπων διδύμων έχουν συχνά πολύ παρόμοιους τύπους σχεδίων μεγέθους και σχήματος. Ωστόσο, τα χαρακτηριστικά αναγνώρισης είναι διαφορετικά. Ο παραπάνω πίνακας παραθέτει τους συντελεστές συσχέτισης μεταξύ του μεγέθους και του σχήματος των δακτυλικών αποτυπωμάτων που βρέθηκαν σε μια μελέτη.

Αυτό δείχνει ότι είναι πιο πιθανό να μοιράζεστε τον τύπο μοτίβου με τα μέλη της οικογένειάς σας παρά με ένα άσχετο άτομο, αλλά τα χαρακτηριστικά FRS που αναγνωρίζετε θα είναι πάντα μοναδικά.


Τι είναι η κληρονομικότητα;

Η κληρονομικότητα είναι ένα μέτρο του πόσο καλά οι διαφορές στα γονίδια των ανθρώπων εξηγούν τις διαφορές στα χαρακτηριστικά τους. Τα χαρακτηριστικά μπορεί να περιλαμβάνουν χαρακτηριστικά όπως το ύψος, το χρώμα των ματιών και τη νοημοσύνη, καθώς και διαταραχές όπως η σχιζοφρένεια και η διαταραχή του φάσματος του αυτισμού. Με επιστημονικούς όρους, η κληρονομικότητα είναι μια στατιστική έννοια (που αναπαρίσταται ως h²) που περιγράφει πόσο μεγάλο μέρος της παραλλαγής σε ένα δεδομένο χαρακτηριστικό μπορεί να αποδοθεί σε γενετική παραλλαγή. Η εκτίμηση της κληρονομικότητας ενός χαρακτηριστικού είναι συγκεκριμένη για έναν πληθυσμό σε ένα περιβάλλον και μπορεί να αλλάξει με την πάροδο του χρόνου καθώς αλλάζουν οι συνθήκες.

Οι εκτιμήσεις κληρονομικότητας κυμαίνονται από μηδέν έως ένα. Μια κληρονομικότητα κοντά στο μηδέν δείχνει ότι σχεδόν όλη η μεταβλητότητα ενός χαρακτηριστικού μεταξύ των ανθρώπων οφείλεται σε περιβαλλοντικούς παράγοντες, με πολύ μικρή επίδραση από γενετικές διαφορές. Χαρακτηριστικά όπως η θρησκεία, η ομιλούμενη γλώσσα και οι πολιτικές προτιμήσεις έχουν μηδενική κληρονομικότητα επειδή δεν υπόκεινται σε γενετικό έλεγχο. Μια κληρονομικότητα κοντά στο ένα δείχνει ότι σχεδόν όλη η μεταβλητότητα σε ένα χαρακτηριστικό προέρχεται από γενετικές διαφορές, με πολύ μικρή συμβολή από περιβαλλοντικούς παράγοντες. Πολλές διαταραχές που προκαλούνται από μεταλλάξεις σε μεμονωμένα γονίδια, όπως η φαινυλκετονουρία (PKU), έχουν υψηλή κληρονομικότητα. Τα περισσότερα σύνθετα χαρακτηριστικά των ανθρώπων, όπως η ευφυΐα και οι πολυπαραγοντικές ασθένειες, έχουν μια κληρονομικότητα κάπου στη μέση, υποδηλώνοντας ότι η μεταβλητότητά τους οφείλεται σε συνδυασμό γενετικών και περιβαλλοντικών παραγόντων.

Η κληρονομικότητα έχει ιστορικά εκτιμηθεί από μελέτες διδύμων. Τα πανομοιότυπα δίδυμα δεν έχουν σχεδόν καμία διαφορά στο DNA τους, ενώ τα αδερφικά δίδυμα μοιράζονται, κατά μέσο όρο, το 50 τοις εκατό του DNA τους. Εάν ένα χαρακτηριστικό φαίνεται να είναι πιο όμοιο σε πανομοιότυπα δίδυμα παρά σε αδελφικά δίδυμα (όταν μεγάλωσαν μαζί στο ίδιο περιβάλλον), οι γενετικοί παράγοντες πιθανότατα παίζουν σημαντικό ρόλο στον προσδιορισμό αυτού του χαρακτηριστικού. Συγκρίνοντας ένα χαρακτηριστικό σε πανομοιότυπα δίδυμα με αδελφικά δίδυμα, οι ερευνητές μπορούν να υπολογίσουν μια εκτίμηση της κληρονομικότητάς του.

Η κληρονομικότητα μπορεί να είναι δύσκολο να κατανοηθεί, επομένως υπάρχουν πολλές παρανοήσεις σχετικά με το τι μπορεί και τι δεν μπορεί να μας πει για ένα δεδομένο χαρακτηριστικό:

Η κληρονομικότητα δεν υποδεικνύει ποια αναλογία ενός χαρακτηριστικού καθορίζεται από τα γονίδια και ποια αναλογία καθορίζεται από το περιβάλλον. Έτσι, μια κληρονομικότητα 0,7 δεν σημαίνει ότι ένα χαρακτηριστικό προκαλείται κατά 70% από γενετικούς παράγοντες, σημαίνει ότι το 70% της μεταβλητότητας του χαρακτηριστικού σε έναν πληθυσμό οφείλεται σε γενετικές διαφορές μεταξύ των ανθρώπων.

Η γνώση της κληρονομικότητας ενός χαρακτηριστικού δεν παρέχει πληροφορίες σχετικά με τα γονίδια ή τις περιβαλλοντικές επιρροές που εμπλέκονται ή πόσο σημαντικά είναι για τον προσδιορισμό του χαρακτηριστικού.

Το Heritable δεν είναι το ίδιο με το οικογενειακό. Ένα χαρακτηριστικό περιγράφεται ως οικογενειακό εάν το μοιράζονται μέλη μιας οικογένειας. Χαρακτηριστικά μπορούν να εμφανιστούν στις οικογένειες για πολλούς λόγους εκτός από γενετικούς, όπως ομοιότητες στον τρόπο ζωής και στο περιβάλλον. Για παράδειγμα, η γλώσσα που ομιλείται τείνει να μοιράζεται σε οικογένειες, αλλά δεν έχει γενετική συμβολή και επομένως δεν είναι κληρονομική.

Η κληρονομικότητα δεν δίνει καμία πληροφορία σχετικά με το πόσο εύκολο ή δύσκολο είναι να αλλάξεις ένα χαρακτηριστικό. Για παράδειγμα, το χρώμα των μαλλιών είναι ένα χαρακτηριστικό με υψηλή κληρονομικότητα, αλλά είναι πολύ εύκολο να αλλάξει με τη βαφή.

Εάν η κληρονομικότητα παρέχει τόσο περιορισμένες πληροφορίες, γιατί τις μελετούν οι ερευνητές; Η κληρονομικότητα έχει ιδιαίτερο ενδιαφέρον για την κατανόηση χαρακτηριστικών που είναι πολύ περίπλοκα με πολλούς παράγοντες που συμβάλλουν. Η κληρονομικότητα μπορεί να δώσει αρχικές ενδείξεις ως προς τις σχετικές επιρροές της «φύσης» (γενετική) και της «ανατροφής» (περιβάλλοντος) σε πολύπλοκα χαρακτηριστικά και μπορεί να δώσει στους ερευνητές ένα μέρος να αρχίσουν να ξεχωρίζουν τους παράγοντες που επηρεάζουν αυτά τα χαρακτηριστικά.


Γονίδια και Νόσος Αλτσχάιμερ

Υπάρχουν δύο τύποι Αλτσχάιμερ—πρώιμη και όψιμη έναρξη. Και οι δύο τύποι έχουν ένα γενετικό συστατικό.

Νόσος Αλτσχάιμερ όψιμης έναρξης

Τα περισσότερα άτομα με Αλτσχάιμερ έχουν την όψιμη εμφάνιση της νόσου, στην οποία τα συμπτώματα γίνονται εμφανή στα μέσα της δεκαετίας του '60 και αργότερα.

Οι ερευνητές δεν έχουν βρει ένα συγκεκριμένο γονίδιο που προκαλεί άμεσα την όψιμη έναρξη της νόσου του Αλτσχάιμερ. Ωστόσο, έχοντας μια γενετική παραλλαγή της απολιποπρωτεΐνης Ε (ΑΠΟΕ) γονίδιο στο χρωμόσωμα 19 αυξάνει τον κίνδυνο ενός ατόμου. ο ΑΠΟΕ γονίδιο εμπλέκεται στη δημιουργία μιας πρωτεΐνης που βοηθά στη μεταφορά της χοληστερόλης και άλλων τύπων λίπους στην κυκλοφορία του αίματος.

ΑΠΟΕ έρχεται σε πολλές διαφορετικές μορφές, ή αλληλόμορφα. Κάθε άτομο κληρονομεί δύο ΑΠΟΕ αλληλόμορφα, ένα από κάθε βιολογικό γονέα.

  • Το APOE ε2 είναι σχετικά σπάνιο και μπορεί να παρέχει κάποια προστασία έναντι της νόσου. Εάν η νόσος του Αλτσχάιμερ εμφανιστεί σε ένα άτομο με αυτό το αλληλόμορφο, συνήθως αναπτύσσεται αργότερα στη ζωή από ό,τι σε κάποιον με το γονίδιο APOE ε4.
  • Το APOE ε3, το πιο κοινό αλληλόμορφο, πιστεύεται ότι παίζει ουδέτερο ρόλο στη νόσο — ούτε μειώνοντας ούτε αυξάνοντας τον κίνδυνο.
  • Το APOE ε4 αυξάνει τον κίνδυνο για τη νόσο του Alzheimer και σχετίζεται επίσης με μικρότερη ηλικία έναρξης της νόσου. Η ύπαρξη ενός ή δύο αλληλόμορφων APOE ε4 αυξάνει τον κίνδυνο εμφάνισης Αλτσχάιμερ. Περίπου το 25 τοις εκατό των ανθρώπων φέρει ένα αντίγραφο του APOE ɛ4 και το 2 έως 3 τοις εκατό φέρει δύο αντίγραφα.

Το APOE ε4 ονομάζεται γονίδιο παράγοντα κινδύνου επειδή αυξάνει τον κίνδυνο ενός ατόμου να αναπτύξει τη νόσο. Ωστόσο, η κληρονομικότητα ενός αλληλόμορφου APOE ε4 δεν σημαίνει ότι ένα άτομο θα αναπτύξει σίγουρα Αλτσχάιμερ. Μερικοί άνθρωποι με αλληλόμορφο APOE ε4 δεν νοσούν ποτέ από τη νόσο και άλλοι που αναπτύσσουν Αλτσχάιμερ δεν έχουν αλληλόμορφα APOE ε4.

Πρόσφατη έρευνα δείχνει ότι σπάνιες μορφές του αλληλόμορφου APOE μπορεί να παρέχουν προστασία έναντι της νόσου του Αλτσχάιμερ. Απαιτούνται περισσότερες μελέτες για να προσδιοριστεί πώς αυτές οι παραλλαγές μπορεί να καθυστερήσουν την εμφάνιση της νόσου ή να μειώσουν τον κίνδυνο ενός ατόμου.

Νόσος Αλτσχάιμερ πρώιμης έναρξης

Η πρώιμη έναρξη της νόσου του Αλτσχάιμερ είναι σπάνια, αντιπροσωπεύοντας λιγότερο από το 10 τοις εκατό όλων των ατόμων με Αλτσχάιμερ. Συνήθως εμφανίζεται μεταξύ των 30 και των 60 ετών ενός ατόμου. Ορισμένες περιπτώσεις προκαλούνται από μια κληρονομική αλλαγή σε ένα από τα τρία γονίδια.

Οι τρεις μονογονιδιακές μεταλλάξεις που σχετίζονται με την πρώιμη έναρξη της νόσου του Αλτσχάιμερ είναι:

  • Πρόδρομη πρωτεΐνη αμυλοειδούς (APP) στο χρωμόσωμα 21
  • Πρεσενιλίνη 1 (PSEN1) στο χρωμόσωμα 14
  • Πρεσενιλίνη 2 (PSEN2) στο χρωμόσωμα 1

Οι μεταλλάξεις σε αυτά τα γονίδια έχουν ως αποτέλεσμα την παραγωγή μη φυσιολογικών πρωτεϊνών που σχετίζονται με τη νόσο. Κάθε μία από αυτές τις μεταλλάξεις παίζει ρόλο στη διάσπαση της APP, μιας πρωτεΐνης της οποίας η ακριβής λειτουργία δεν είναι ακόμη πλήρως κατανοητή. Αυτή η διάσπαση είναι μέρος μιας διαδικασίας που δημιουργεί επιβλαβείς μορφές αμυλοειδών πλακών, χαρακτηριστικό της νόσου του Αλτσχάιμερ.

Ένα παιδί του οποίου η βιολογική μητέρα ή ο πατέρας φέρει μια γενετική μετάλλαξη για ένα από αυτά τα τρία γονίδια έχει 50/50 πιθανότητες να κληρονομήσει αυτή τη μετάλλαξη. Εάν η μετάλλαξη είναι στην πραγματικότητα κληρονομική, το παιδί έχει πολύ μεγάλη πιθανότητα να αναπτύξει πρώιμη νόσο Αλτσχάιμερ.

Για άλλες περιπτώσεις πρώιμης εμφάνισης Αλτσχάιμερ, η έρευνα έδειξε ότι εμπλέκονται και άλλα γενετικά συστατικά. Οι μελέτες βρίσκονται σε εξέλιξη για τον εντοπισμό πρόσθετων παραλλαγών γενετικού κινδύνου.

Το σύνδρομο Down αυξάνει τον κίνδυνο εμφάνισης πρώιμης έναρξης της νόσου του Αλτσχάιμερ. Πολλοί άνθρωποι με σύνδρομο Down αναπτύσσουν Αλτσχάιμερ καθώς μεγαλώνουν, με συμπτώματα να εμφανίζονται στα 50 ή στα 60 τους. Οι ερευνητές πιστεύουν ότι αυτό συμβαίνει επειδή τα άτομα με σύνδρομο Down γεννιούνται με ένα επιπλέον αντίγραφο του χρωμοσώματος 21, το οποίο φέρει το γονίδιο APP.


Wars της μήτρας

Όπως θυμάται όποιος πήρε το Biology 101, είμαστε όλοι σύνθετοι των γονιών μας. Η μαμά μας δίνει το 50 τοις εκατό του DNA μας και ο μπαμπάς μας γεμίζει το άλλο μισό. Αλλά μόνο οι μαθητές που έδιναν πραγματικά προσοχή είναι πιθανό να θυμηθούν ότι δεν εκφράζονται όλα τα γονίδια εξίσου. Σε πολλά θηλαστικά, η ζυγαριά φαίνεται να είναι στραμμένη προς τους πατέρες, των οποίων τα γονίδια συχνά κερδίζουν τον πόλεμο που διεξάγεται στη μήτρα.

Αυτό οφείλεται εν μέρει στο περίπλοκο παζλ που είναι γνωστό ως επιγενετική. Βασικά, η επιγενετική επηρεάζει τον τρόπο με τον οποίο εκφράζεται πραγματικά το DNA σας. Αυτό μπορεί να αλλάξει το σπέρμα του μπαμπά σας, το οποίο με τη σειρά του μπορεί να σας επηρεάσει. Μπορεί επίσης να επηρεάσει τον τρόπο με τον οποίο διαβάζονται τα γονίδια που έχετε - και οι πρωτεΐνες που παράγουν - κατά τη διάρκεια της ζωής σας.

Πάρτε, για παράδειγμα, μια μελέτη του 2015 στο Γενετική της Φύσης που έδειξε ότι η έκφραση χιλιάδων διαφορετικών γονιδίων σε ποντίκια διέφερε ανάλογα με το αν προέρχονταν από μαμά ή μπαμπά. Ενώ κάθε γονέας συνεισέφερε τεχνικά το ήμισυ του γονιδιώματος ενός απογόνου, περίπου το 60 τοις εκατό των γονιδίων του μπαμπά ήταν πιο εκφραστικά από τα γονίδια της μαμάς.

Αυτοί οι επιγενετικοί παράγοντες μπορούν να παίξουν ρόλο σε πολλά σημεία της ζωής σας, αλλά δεν αφορούν μόνο ιδιορρυθμίες όπως το χρώμα των ματιών ή το αν μπορείτε ή όχι να κυλήσετε τη γλώσσα σας. Οι ερευνητές πιστεύουν ότι η διαφορετική έκφραση μπορεί επίσης να αλλάξει την ψυχική και σωματική σας ευεξία. Εάν η μαμά έχει προδιάθεση για μια δεδομένη ασθένεια, μπορεί να την κληρονομήσετε. Αλλά αν ο πατέρας σας μεταδίδει γονίδια που μεταδίδουν μια ασθένεια ή μια μετάλλαξη κάποιου είδους, μπορεί να είναι πιο πιθανό να είστε άρρωστοι και εσείς, απλώς και μόνο επειδή τα γονίδιά του είναι πιο πιθανό να εκφραστούν.


Το πρόβλημα με την αιμομιξία

Ο κ. James Russell των Cashiers, North Carolina, πρόσφατα δικαιολογούσε την κρεατοφαγία στις σελίδες του Asheville Citizen-Times με το επιχείρημα ότι οι άνθρωποι ταξινομούνται βιολογικά ως σαρκοφάγα. Το σκεπτικό του ήταν απλό. Η κατανάλωση ζωικής σάρκας είναι ηθικά σωστή γιατί είναι φυσική.

Δυστυχώς, ο κ. Russell πήρε λάθος τα δεδομένα του. Οι ζωολόγοι τοποθετούν τους ανθρώπους στη σειρά Αρχιεπίσκοπος (οικογένεια Hominidea), όχι με τη σειρά Σαρκοφάγα ζώα. Επιπλέον, όπως οι αρουραίοι, οι άνθρωποι είναι παμφάγοι, όχι σαρκοφάγοι. Αλλά πιο ανησυχητική είναι η πεποίθηση του κ. Ράσελ ότι οι άνθρωποι πρέπει να αναζητούν ηθική καθοδήγηση στη φύση. Δικαιολογεί την κρεατοφαγία στους ανθρώπους με το σκεπτικό ότι άλλα ζώα τρώνε το ένα το άλλο. Υποψιάζομαι, ωστόσο, ότι δεν εγκρίνει τους ομαδικούς βιασμούς, τη μοιχεία, τον κανιβαλισμό και την κατανάλωση κοπράνων, που όλα αυτά ασκούνται στη φύση από τα τετράποδα αδέρφια μας. Ενώ υπάρχουν ηθικοί κώδικες σε άλλα είδη (δείτε εδώ), οι άνθρωποι έχουν την ικανότητα —και μάλιστα την ευθύνη— να λειτουργούν σε ένα υψηλότερο ηθικό επίπεδο.

Το (σχεδόν) παγκόσμιο ταμπού

Σε θέματα ηθικής, γενικά συμφωνώ με την Κάθριν Χέπμπορν που έκανε πλάκα στον Χάμφρεϊ Μπόγκαρτ το Η Αφρικανή Βασίλισσα, "Η φύση είναι αυτό που έχουμε θέσει σε αυτόν τον κόσμο να υψωθούμε πάνω." Υπάρχει, ωστόσο, μια εξαίρεση στον ισχυρισμό μου ότι οι άνθρωποι δεν πρέπει να στραφούν στη φύση για ηθική καθοδήγηση. Είναι ο κανόνας που λέει: «Μην κάνετε σεξ με συγγενείς πρώτου βαθμού.» Οι συγγενείς πρώτου βαθμού είναι τα άτομα με τα οποία μοιράζεστε το 50 τοις εκατό των γονιδίων σας—οι γονείς, τα παιδιά και τα αδέρφια σας. Πράγματι, τα μη ανθρώπινα ζώα έχουν εξελίξει μια σειρά από στρατηγικές για την πρόληψη της αιμομιξίας (εδώ). Ακόμη και τα φυτά διαθέτουν μηχανισμούς κατά της αιμομιξίας (εδώ).

Όπως τόνισαν οι ψυχολόγοι Debra Lieberman και Adam Smith από το Πανεπιστήμιο του Μαϊάμι σε πρόσφατο άρθρο στο περιοδικό Τρέχουσες Κατευθύνσεις στην Ψυχολογική Επιστήμη, οι άνθρωποι έχουν κοινωνικούς και ψυχολογικούς μηχανισμούς για να αποτρέψουν την αιμομιξία. Με ελάχιστες εξαιρέσεις, οι γάμοι μεταξύ αδελφών και αδελφών και μεταξύ γονέων και των παιδιών τους είναι απηγορευμένος σε κάθε ανθρώπινο πολιτισμό. Ο πρωταρχικός ψυχολογικός μηχανισμός κατά της αιμομιξίας είναι η απάντηση yuck. Ακόμα και η ιδέα του σεξ με τη μαμά ή τον μπαμπά ή τον αδερφό ή την αδερφή είναι ενοχλητική για τους περισσότερους ανθρώπους. Ο ψυχολόγος Jonathan Haidt ανακάλυψε ότι σχεδόν όλοι απωθούνται από την προοπτική του σεξ αδελφών-αδερφών, ακόμη και σε υποθετικές καταστάσεις στις οποίες δεν υπάρχει πιθανότητα εγκυμοσύνης (εδώ).

Το βιολογικό κόστος της αιμομιξίας

Αυτό εγείρει ένα ενδιαφέρον ερώτημα: Τι είναι τόσο κακό στην αιμομιξία; Σίγουρα, το να κάνεις σεξ με τον μπαμπά σου ή την αδερφή σου φαίνεται αηδιαστικό. Μα γιατί? Μερικοί ανθρωπολόγοι έχουν υποστηρίξει ότι τα ταμπού της αιμομιξίας είναι μαθημένες κοινωνικές συμβάσεις. Αυτή η εξήγηση, ωστόσο, δεν έχει νόημα για μένα, καθώς δεν εξηγεί την ευρεία ύπαρξη μηχανισμών κατά της αιμομιξίας σε πλάσματα που κυμαίνονται από κατσαρίδες έως χιμπατζήδες (εδώ). Δεύτερον, το ταμπού της αιμομιξίας είναι σχεδόν τόσο κοντά σε έναν παγκόσμιο νόμο όσο οι ανθρώπινοι ηθικοί κανόνες.

Γιατί θα έπρεπε οι μηχανισμοί αποφυγής της αιμομιξίας να είναι τόσο διαδεδομένοι τόσο στη φύση όσο και σε όλες τις ανθρώπινες κοινωνίες; Η απάντηση είναι απλή. Το πρόβλημα με το να κάνετε σεξ κοντά με συγγενείς είναι ότι υπάρχει εκπληκτικά μεγάλη πιθανότητα ο απόγονός σας να γεννηθεί με σοβαρό γενετικό ελάττωμα. Πάρτε τα αποτελέσματα:

Ποσοστό παιδιών με σοβαρές συγγενείς ανωμαλίες.

Πηγή: Μελέτη παιδιών από την Τσεχοσλοβακία των οποίων οι πατέρες ήταν συγγενείς πρώτου βαθμού. Λιγότερα από τα μισά παιδιά που ήταν προϊόν αιμομιξικών ενώσεων ήταν απολύτως υγιή. Το σαράντα δύο τοις εκατό από αυτούς γεννήθηκαν με σοβαρές γενετικές ανωμαλίες ή υπέστησαν πρόωρο θάνατο και ένα άλλο 11 τοις εκατό με ήπια διανοητική αναπηρία. Αυτή η μελέτη είναι ιδιαίτερα διδακτική καθώς περιελάμβανε μια μοναδική ομάδα ελέγχου - τους απογόνους των ίδιων μητέρων αλλά των οποίων οι πατέρες δεν ήταν συγγενείς των μητέρων. Όταν οι ίδιες γυναίκες εμποτίστηκαν από μη συγγενή, μόνο το 7 τοις εκατό των παιδιών τους γεννήθηκαν με εκ γενετής ελάττωμα (Εικόνα 1).

Μια ομάδα γενετικών συμβούλων εξέτασε την έρευνα σχετικά με τις βιολογικές συνέπειες του σεξ μεταξύ συγγενών (συγγενικές σχέσεις) (εδώ). Βρήκαν μια εκπληκτικά μικρή αύξηση (περίπου 4 τοις εκατό) στις γενετικές ανωμαλίες μεταξύ των παιδιών παντρεμένων ξαδέλφων. Η αιμομιξία μεταξύ συγγενών πρώτου βαθμού, ωστόσο, ήταν μια διαφορετική ιστορία. Οι ερευνητές εξέτασαν τέσσερις μελέτες (συμπεριλαμβανομένης της τσέχικης έρευνας) σχετικά με τις επιπτώσεις της αιμομιξίας πρώτου βαθμού στην υγεία των απογόνων. Το σαράντα τοις εκατό των παιδιών γεννήθηκαν είτε με αυτοσωμικές υπολειπόμενες διαταραχές, συγγενείς σωματικές δυσπλασίες ή σοβαρά διανοητικά ελλείμματα. Και ένα άλλο 14 τοις εκατό από αυτούς είχαν ήπιες νοητικές αναπηρίες. Εν ολίγοις, οι πιθανότητες ένα νεογέννητο παιδί που είναι προϊόν αιμομιξίας αδερφού-αδερφής ή πατέρα-κόρης να υποστεί πρόωρο θάνατο, σοβαρό γενετικό ελάττωμα ή κάποια διανοητική ανεπάρκεια πλησιάζει το 50%.

Ανόητες Συνέπειες και Μικρά Μυαλά

Οι βαθιές αρνητικές επιπτώσεις της αιμομιξίας στα αγέννητα παιδιά εγείρουν ζητήματα ηθικής συνέπειας και πολιτικής για τις αμβλώσεις. Καταλαβαίνω το επιχείρημα υπέρ της ζωής. Εάν πιστεύετε ότι η ανθρώπινη ζωή ξεκινά τη στιγμή που το σπέρμα συναντά το ωάριο, είναι απολύτως λογικό να αντιταχθείτε στην άμβλωση. Αλλά σε ποιο σημείο οι λογικοί άνθρωποι μετριάζουν τη λογική συνέπεια με τη συμπόνια και την κοινή λογική;

Κατά τη διάρκεια της συνέλευσης του Ρεπουμπλικανικού Κόμματος το 2012 στην Τάμπα, η Επιτροπή Πλατφόρμας αγωνίστηκε με μια πτυχή του επιχειρήματος κατά της νόμιμης άμβλωσης. Σχεδόν όλοι στην επιτροπή συμφώνησαν ότι οι αμβλώσεις πρέπει να απαγορευθούν. Ωστόσο, τα μέλη της επιτροπής διχάστηκαν σχετικά με το εάν το επίσημο δόγμα του κόμματος θα έπρεπε να περιλαμβάνει εξαιρέσεις από την απαγόρευση των αμβλώσεων εάν ένα έμβρυο ήταν αποτέλεσμα βιασμού ή αιμομιξίας. Τελικά επικράτησε η ιδεολογική καθαρότητα. Η επίσημη πλατφόρμα των Ρεπουμπλικανών αναφέρει, "Διεκδικούμε την εγγενή αξιοπρέπεια και την ιερότητα όλης της ανθρώπινης ζωής και βεβαιώνουμε ότι το αγέννητο παιδί έχει ένα θεμελιώδες ατομικό δικαίωμα στη ζωή που δεν μπορεί να παραβιαστεί.» Χωρίς εξαιρέσεις, τελεία. Ακόμη και σε περιπτώσεις συγγενούς αιμομιξίας πρώτου βαθμού.

Παραδέχομαι διστακτικά ότι η έλλειψη όποιος Η εξαίρεση στην επίσημη θέση των Ρεπουμπλικανών για τις αμβλώσεις είναι λογικά συνεπής με τη δήλωση του κόμματος για την «ιερότητα όλης της ανθρώπινης ζωής». Αλλά δεν θα έπρεπε μερικές φορές η λογική να μετριάζεται με συμπόνια; Ο Έμερσον έγραψε το περίφημο: «Μια ανόητη συνέπεια είναι το χιούμορ των μικρών μυαλών, που λατρεύονται από μικρούς πολιτικούς και φιλοσόφους και θεούς».

Ο εξαναγκασμός μιας γυναίκας με τα ψυχολογικά σημάδια της αιμομιξίας να γεννήσει ένα παιδί που έχει περίπου 50:50 πιθανότητες να έχει νοητικές αναπηρίες ή σοβαρό εκ γενετής ελάττωμα είναι ίσως το απόλυτο παράδειγμα μιας ανόητης συνέπειας που απευθύνεται σε μικρούς πολιτικούς.


Ένας από τους ακόλουθους του ιστολογίου μας, ο Ron, έκανε την εξής ερώτηση:

“Ο αείμνηστος πατέρας μου και ο αδερφός του γεννήθηκαν και μεγάλωσαν στο νησί Hatteras που ήταν μια πολύ απομονωμένη κοινότητα μέχρι σχετικά πρόσφατα. Περίεργος για τη γενετική τους καταγωγή, έβαλα τον θείο μου να κάνει το τεστ Family Tree DNA Family Finder. Τα αποτελέσματά του για το Family (Population) Finder ήταν:

Ευρώπη (Δυτική Ευρώπη) – Ορκαδική 91,37% ±2,82%

Μέσης Ανατολής – Παλαιστίνιοι, Βεδουίνοι, Νότιοι Βεδουίνοι, Δρούζοι, Εβραίοι, Μοζαβίτες 8,63% ±2,82%

Το 8,63% της Μέσης Ανατολής ήταν εκπληκτικό αφού οι περισσότεροι, αν όχι όλοι οι πρόγονοί του, που χρονολογούνται 4 ή περισσότερες γενιές πίσω, γεννήθηκαν στο OBX (Εξωτερικές Τράπεζες). Οι περισσότερες από τις αρχικές οικογένειες στο νησί Hatteras έχουν τις ρίζες τους στα Βρετανικά Νησιά και τη δυτική Ευρώπη.

Δεδομένου ότι οι γονείς της μητέρας μου ήταν μετανάστες από την ανατολική Ευρώπη, σκέφτηκα ότι θα ήταν ενδιαφέρον να μάθω ποιες συνεισφορές πρόσθεσαν οι παππούδες και οι γιαγιάδες μου στη γενετική μου καταγωγή, οπότε υπέβαλα δείγματα DNA μου για το ίδιο τεστ. Το τεστ Finder Πληθυσμού έδειξε ότι ήμουν Europe Orcadian 100,00% ±0,00%. Σοκαρίστηκα που κάποιος άλλος πληθυσμός δεν φάνηκε στα αποτελέσματα.

Μπορείτε να με βοηθήσετε να καταλάβω πώς καθορίζονται οι αντιπροσωπευτικοί πληθυσμοί και γιατί η Μέση Ανατολή δεν εμφανίστηκε στο δείγμα μου;”

Ναι, πράγματι, το τρομακτικό αποτέλεσμα της «Μέσης Ανατολής». Το έχω δει αυτό ξανά και ξανά. Ας μιλήσουμε για το τι είναι αυτό και γιατί μπορεί να συμβεί. Όπως συμβαίνει, το γεγονός ότι ο Ray είναι από το νησί Hatteras μας παρέχει μια θαυμάσια ευκαιρία έρευνας, επειδή είναι ένας πληθυσμός με τον οποίο είμαι αρκετά εξοικειωμένος.

Δεδομένου ότι ο Dawn Taylor και εγώ διαχειριζόμαστε τα Έργα DNA των Οικογενειών Hatteras (Υ-γραμμή, mtDNA και αυτοσωμικό), έχω μια καλή διαχείριση της γενεαλογίας των οικογενειών του νησιού Hatteras. Έχουν ιδιαίτερο ενδιαφέρον επειδή το νησί Hatteras είναι όπου οι Χαμένοι Αποίκοι του Sir Walter Raleigh φημολογείται ότι πήγαν και συγχωνεύτηκαν με τους Ινδιάνους Hatteras. Οι Ινδιάνοι Hatteras με τη σειρά τους φαίνεται να έχουν εν μέρει πεθάνει και εν μέρει παντρεύτηκαν με τον πληθυσμό των ευρωπαϊκών νησιών. Τόσο το έργο Lost Colony Project όσο και το Hatteras DNA Projects στη διεύθυνση http://www.familytreedna.com/public/HatterasFathers και http://www.rootsweb.ancestry.com/

Οι molcgdrg/hatteras/hifr-index.htm βρίσκονται σε εξέλιξη και περιλαμβάνονται όλες οι οικογένειες Hatteras.

Ως μέρος της προσπάθειας των οικογενειών Hatteras, η Dawn και εγώ έχουμε συγκεντρώσει μια βάση δεδομένων των οικογενειών Hatteras με περισσότερους από 5000 πρώιμους αποίκους και τους απογόνους τους μέχρι το έτος 1900 περίπου. Αυτό που λέει ο Ρον είναι ακριβές. Οι περισσότερες από τις οικογένειες των νησιών Hatteras εγκαταστάθηκαν στο νησί αρκετά νωρίς, ξεκινώντας περίπου το 1710. Σχεδόν όλες ήρθαν από τη Βιρτζίνια, άλλες απευθείας και άλλες αφού εγκαταστάθηκαν στην ηπειρωτική χώρα της Βόρειας Νότιας Αμερικής για μια γενιά περίπου στις γύρω κομητείες. Μέχρι το 1750, σχεδόν όλες οι οικογένειες που βρέθηκαν εκεί το 1900 ήταν παρούσες. Πράγματι, λοιπόν, αυτό το απομονωμένο νησί εγκαταστάθηκε από μια ομάδα ανθρώπων από τα βρετανικά νησιά και μερικοί από αυτούς παντρεύτηκαν με τον τοπικό πληθυσμό των Ινδιάνων Hatteras.

Μόλις στο νησί, ήταν ασυνήθιστο να παντρεύονται εκτός του πληθυσμού του νησιού, έτσι έχουμε την κατάσταση γνωστή ως ενδογαμία, όπου ένας απομονωμένος πληθυσμός παντρεύεται επανειλημμένα μέσα του. Άλλα παραδείγματα αυτού είναι οι Amish και οι εβραϊκοί πληθυσμοί. Όταν συμβαίνει αυτό, η ιδρυτική ομάδα του DNA των ανθρώπων περνάει σε κύκλους, ας πούμε έτσι, και δεν εισάγεται νέο DNA.

Συνήθως αυτό που συμβαίνει είναι ότι σε κάθε γενιά, το 50% «νέο» DNA εισάγεται από τον άλλο γονέα. Όταν το νέο DNA προέρχεται από κάποιον μη συγγενή, είναι σχετικά εύκολο να διευθετηθεί χρησιμοποιώντας τα σημερινά εργαλεία φάσης DNA. Αλλά όταν το «νέο» DNA δεν είναι καθόλου νέο, αλλά προέρχεται από το ίδιο προγονικό απόθεμα με τον άλλο γονέα, έχει ως αποτέλεσμα να κάνει τις σχέσεις να φαίνονται «πιο στενές» με τον καιρό.

Φέρετε τα ακόλουθα μέσα ποσοστά DNA από αυτούς τους συγγενείς:

  • Γονείς 50% από κάθε γονέα
  • Παππούδες 25%
  • Προπαππούδες 12,5%
  • Προ-προπαππούδες 6,5%

Όπως μπορείτε να δείτε, το ποσοστό χωρίζεται σε κάθε γενιά. Ωστόσο, εάν δύο από τους προπαππούδες σας είναι το ίδιο άτομο, τότε στην πραγματικότητα μεταφέρετε το 25% του DNA από αυτό το άτομο και όχι το 12,5. Όταν εξετάζετε αγώνες με άλλα άτομα σε μια ενδογαμική κοινότητα, σχεδόν όλοι φαίνονται πιο στενά συνδεδεμένοι από ό, τι είναι στα χαρτιά λόγω της σωρευτικής επίδρασης των κοινών προγόνων. Στην ουσία, γενετικά, είναι πολύ πιο κοντά από ό,τι φαίνονται σε ένα γενεαλογικό γενεαλογικό χάρτη.

Εντάξει, πίσω στην ερώτηση. Από πού προήλθε η Μέση Ανατολή;

Κοιτάζοντας τα παραπάνω ποσοστά, μπορείτε να δείτε ότι αν ο θείος του Ρέι ήταν στην πραγματικότητα 8% (συν ή μείον περίπου 2%, έτσι θα το ονομάσουμε απλώς 8%) Μέσης Ανατολής, ο συγγενής του στη Μέση Ανατολή θα ήταν είτε προπάππους. ή ένας προ-προπάππους. Δεδομένου ότι η διάρκεια της γενιάς είναι συνήθως 25 έως 30 χρόνια, υποθέτοντας τη γέννηση του Ray το 1960 και των θείων του το 1940, αυτό σημαίνει ότι αυτό το άτομο της Μέσης Ανατολής θα ζούσε στο νησί Hatteras μεταξύ 1835 και 1860 χρησιμοποιώντας γενιές 25 ετών και μεταξύ 1810 και 1840 χρησιμοποιώντας Γενιές 30 ετών. Έχοντας δουλέψει εκτενώς με τους αρχικούς δίσκους, μπορώ να σας διαβεβαιώσω ότι δεν υπήρχαν άνθρωποι της Μέσης Ανατολής στο νησί Hatteras εκείνη την εποχή. Επιπλέον, δεν υπήρχαν άνθρωποι της Μέσης Ανατολής στο Hatteras νωρίτερα το 1800 ή το 1700 που αντικατοπτρίζονται στα αρχεία. Αυτό περιλαμβάνει όλα τα υπάρχοντα αρχεία, πράξεις, γάμους, δικαστήρια, φόρους, απογραφή κ.λπ.

Αυτό που βρίσκουμε, ωστόσο, είναι και οι ιθαγενείς της Αμερικής, οι σκλάβοι και οι ελεύθεροι έγχρωμοι άνθρωποι που μπορεί να είναι μια ανάμειξη του ενός ή και των δύο με τους Ευρωπαίους. Στην πραγματικότητα, βρίσκουμε μια ολόκληρη κοινότητα δίπλα στο ινδικό χωριό που είναι ανακατεμένη.

Δημοσιεύσαμε ένα άρθρο στο ενημερωτικό δελτίο της Lost Colony Research Group που συζητά αυτή τη μικτή κοινότητα όταν εντοπίσαμε τις οικογένειες που εμπλέκονται. Έχει τον τίτλο «Will the Real Scarborough, Basnett and Whidbee Please Stand Up» και περιγράφει λεπτομερώς τα ευρήματά μας.

Αυτές οι οικογένειες ήταν παρούσες στο νησί και είχαν καταγραφεί ως «έγχρωμες» πριν από το 1790, έτσι οι επιγαμίες συνέβησαν νωρίς στην ιστορία του νησιού.

Επιπλέον, αυτές οι οικογένειες συνέχισαν να παντρεύονται και συνέχισαν να ζουν στην ίδια κοινότητα όπως πριν. Μάλιστα, τον Μάιο και τον Ιούνιο του 2012, επισκεφθήκαμε μια γυναίκα που εξακολουθεί να κατέχει την ινδική γη που πούλησαν οι Ινδοί στα μέλη της οικογένειάς της το 1788! Και ναι, το επώνυμο του Ray είναι ένα από τα επώνυμα που παντρεύτηκαν με αυτές τις οικογένειες. Στην πραγματικότητα, ήταν κάποιος με το οικογενειακό του επώνυμο που αγόρασε τη γη που περιελάμβανε το ινδικό χωριό το 1788 από μια Ινδή Hatteras.

Τι μας λέει λοιπόν αυτό;

Έχοντας δουλέψει με τα αυτοσωματικά αποτελέσματα ανθρώπων που αναζητούν μικρές ποσότητες ιθαγενών Αμερικανών καταγωγής, βλέπω συχνά αυτή την πρόσμειξη της «μέσης Ανατολής». Πραγματικά το περιμένω. Δεν πιστεύω ότι είναι ακριβές. I believe, for some reason, tri-racial admixture is being measured as “Middle Eastern.” If you look at the non-Jewish Middle East, this actually makes some sense. There is no other place in the world as highly admixed with a combination of African, European (Caucasian) and Asian. I’m not surprised that early admixture in the US that includes white, African and Native American looks somewhat the same as Middle Eastern in terms of the population as a whole. Regardless of why, this is what we are seeing on a regular basis.

New technology is on the horizon which will, hopefully, resolve some of this ambiguous minority admixture identification. As new discoveries are made, as we discussed when we talked about “Ethnicity Finders” in the blog a few days ago, we learn more and will be able to more acutely refine these minority amounts of trace admixture.

If Ray’s ancestor in 1750 was a Hatteras Indian, and if there was no Lost Colonist European admixture already in the genetic mix, then using a 25 year generation, we would see the following percentages of ethnicity in subsequent generations, assuming marriage to a 100% Caucasian in each generation, as follows:

  • 1750 – 100% Indian
  • 1775 – next generation, married white settler – 50% Indian
  • 1800 – 25% Indian
  • 1825 – 13.5% Indian
  • 1850 — 6.25% Indian
  • 1875 — 3.12% Indian
  • 1900 – 1.56% Indian
  • 1925 – 0.78% Indian
  • 1950 – 0.39% Indian

Remember, however, about endogamy. This group of people were neighbors and lived in a relatively isolated community. They married each other. Every time they married someone else who descended from someone who was a Hatteras Indian in 1750, their percentage of Native Heritage in the subsequent generation doubled as compared to what it would have been without double inheritance. So if Ray’s Uncle is descended several times from Hatteras Indians due to intermarriage within that community, it’s certainly possible that he would carry 6-10% Native admixture. There are also records that suggest possible African admixture early in the Native community.

So now to answer Ray’s last question about inheritance.

Ray wanted to know why he didn’t show any “Middle Eastern” admixture when his uncle did.

Remember that Ray’s Uncle has two “genetic transmission events” that differ from Ray’s line. Ray’s Uncle, even though he had the same parents as Ray’s father, inherited differently from his parents. Children inherit half of their DNA from each parents, but not necessarily the same half. Maybe Ray’s father inherited little or none of the Native admixture. In the next generation, Ray inherited half of his father’s DNA and half of his mother’s. We have no way of knowing in which of these two transmission events Ray lost the Native admixture, or whether it’s there, but in such small pieces that the technology today can’t detect it.

Hopefully the new technology on the horizon will improve all aspects of autosomal admixture analysis and ethnicity detection. But for today, if you see the dreaded “Middle East” result appear as one of your autosomal geographic locations and your family isn’t Jewish and has been in the states since colonial times, think to yourself ‘racial admixture’ and revisit this topic as the technology improves. In other words, as far as I’m concerned, the jury is still out!

Λαμβάνω μια μικρή συνεισφορά όταν κάνετε κλικ σε ορισμένους από τους συνδέσμους προς προμηθευτές στα άρθρα μου. Αυτό ΔΕΝ αυξάνει την τιμή που πληρώνετε, αλλά με βοηθά να κρατάω τα φώτα αναμμένα και αυτό το ενημερωτικό ιστολόγιο δωρεάν για όλους. Κάντε κλικ στους συνδέσμους στα άρθρα ή στους παρακάτω προμηθευτές εάν αγοράζετε προϊόντα ή τεστ DNA.


Examples of Heteropaternal Superfecundation

One way heteropaternal superfecundation could occur is if a woman has sexual intercourse with two different men within the same timeframe that both embryos are conceived. For example, in New Jersey, a mother of twins underwent paternity testing when applying for public assistance. After the test showed that her partner was only the father of one of her twins, she admitted that she had had sex with another man within the same week that her twins were conceived.

Similarly, a mother of twins in Texas acknowledged that she was having an affair with another man when her twins were conceived.   Paternity testing revealed that her fiancee was indeed the father of one of the twin boys, but that another man was the biological father of the other twin.

While we might assume all instances of twins with different fathers are the result of the mother having sexual intercourse with different partners, this isn't the only scenario in which it could happen. This situation can also occur when twins are the result of fertility treatments. For example, in a mixup at a lab, equipment had been used twice, causing another man’s sperm to be mixed with that of the intended father resulting in Dutch twin boys conceived through in vitro fertilization (IVF) with different fathers. ,


13 Rare Genetic Disorders And How They Are Inherited

A genetic disorder, in layman’s terms, is a serious medical condition triggered by irregularities in the genome (gene) which can either be hereditary (inherited from parents) or caused by new alterations to the DNA.

They can be divided into two broad classes single-gene and multiple gene disorders. In a single-gene disorder, also known as monogenic, only a particular gene is mutated or permanently altered.

Most metabolic disorders are caused by single-gene defects. On the other hand, multi-gene disorders are more complex and include more than one faulty gene. They are generally difficult to predict and are largely influenced by environmental factors.

While not all genetic disorders are fatal or directly lead to death, there are currently no known remedies to cure such diseases. Below, we have compiled a list of rare genetic disorders known to us. We have also mentioned how these genetic disorders are inherited.

13. DiGeorge Syndrome

An infant with DiGeorge Syndrome Image courtesy: National Center for Biotechnology Information

Inheritance Pattern: Autosomal dominant (only one affected parent)

22q11.2 deletion syndrome, more commonly known as DiGeorge syndrome is a relatively rare genetic disorder caused by defective chromosome 22. Basically, a small section of chromosome 22 containing about 30 genes is deleted from the DNA.

Symptoms include facial deformities, congenital heart defects (present from birth), along with kidney problems and hearing loss. Patients suffering from this anomaly are likely to have at least one autoimmune disorder and a higher risk of developing Parkinson’s and Schizophrenia.

It was first discovered and documented by physician Angelo DiGeorge in 1968. Its genetic component, however, was not studied until 1981. DiGeorge syndrome affects roughly about 1 in every 4000 people worldwide though it might be more common.

12. Tuberous Sclerosis Complex

Inheritance Pattern: Autosomal dominant

Tuberous Sclerosis Complex (TSC for short) is a single-gene disorder that causes non-cancerous tumors (benign) to develop in multiple organs including liver, lungs, brain, kidneys, skin, and heart. This rare condition is caused by mutations in any one of the two tumor suppressors genes namely TSC1 and TSC2. Don’t confuse it with Tuberculosis (TB).

The most common symptoms of tuberous sclerosis include severe neurological problems such as seizures, intellectual disability, autism, and other neurodevelopmental disorders along with different types of tumors in the aforementioned organs. In rare cases, it can also mess with the pancreas causing pancreatic neuroendocrine tumors.

Most of the TSC cases result from random genetic mutations rather than inheritance. TSC is generally difficult to diagnose since it affects almost all major human organs and has no clear symptoms.

11. Ehlers–Danlos Syndromes

Image Courtesy: Piotr Dołżonek

Inheritance pattern: Autosomal dominant/recessive

Ehlers-Danlos syndromes (EDS) are a group of well-documented genetic disorders associated with connective tissue. The most common symptoms, which are consistent with EDS are stretchy skin, abnormally flexible joints (hypermobility) and scars. Other medical conditions such as scoliosis and early-onset osteoarthritis may also arise.

This genetic condition can be triggered by a mutation in one of nearly a dozen genes. So far, about 13 different sub-types of EDS’ have been recognized. Out of those 13, only two, namely Arthrochalasia EDS and Dermatosparaxis EDS are considered to be extremely rare with just 30 and 10 reported cases respectively.

Patients suffering from Arthrochalasia EDS usually experience congenital hip dysplasia, joint hypermobility, scoliosis, bone loss, and skin problems. Ehlers-Danlos syndromes can either be inherited or caused by new mutations.

10. Hereditary Coproporphyria

Inheritance Pattern: Autosomal dominant

Hereditary coproporphyria (HCP) belongs to a group of acute porphyrias which primarily affects the central nervous system. Individuals suffering from hereditary coproporphyria experience acute episodic attacks involving seizures, severe abdominal pain, high blood pressure, and an abnormal heart rate. Other symptoms include nausea, fragile skin, and scarring.

These attacks are triggered by alcohol, hormonal and lifestyle changes, and can also be chemically induced. Without any triggers, many affected individuals may even go asymptomatic (without signs).

HCP is caused by a deficiency of an enzyme known as coproporphyrinogen oxidase which is caused by mutations in the CPOX gene. In general, porphyrias are rare and have an estimated rate of occurrence (all forms) of about 1 in 20,000.

9. Myoclonic Epilepsy with Ragged Red Fibers

ragged red fibers in muscle fibers (MERRF syndrome)

Inheritance Pattern: Mitochondrial inheritance (maternal)

Mitochondrial DNA is an essential part of the human genome. They are located inside mitochondria, which, as you may know, are practically the powerhouses of individual cells.

Any abnormality in cells can trigger one of many mitochondrial diseases which are mostly inherited and often manifest themselves in various metabolic and neurological disorders. One such mitochondrial disease is myoclonic epilepsy with ragged red fibers or MERRF for short which is extremely rare.

This condition has severe effects on the nervous system and muscles, though it affects most of the body. Most often a person with MERRF show involuntary twitching (myoclonus) as the first symptom, then present with seizures and ataxia (when the brain starts to lose control of the body).

As with other genetic disorders, the actual mechanism behind MERRF is not properly understood but the mutation to the mitochondrial genomes (mitochondrial DNA or nuclear DNA) is understood to be central to this. A distinct physical characteristic of the MERRF is ragged red fibers (dead mitochondria) that accumulate in muscle fiber and are visible on muscle biopsy.

8. Chronic Granulomatous Disease

Microscopic view of granuloma

Inheritance Pattern: Autosomal recessive, X-linked

Chronic granulomatous disease (CGD) is a genetic condition in which the immune system is unable to fend-off invading pathogens completely, making the affected individual vulnerable to all sorts of bacterial and fungal infections.

The disease basically interferes with white blood cell’s ability to produce oxygen compounds necessary for killing harmful organisms. Instead, the immune system forms granulomata (plural for granuloma) in different parts of the body to wall off the bacteria.

CGD is most likely to be caused by mutations on the X chromosome, but alterations on chromosome 7 (CYBA gene) and 16 (NCF1 gene) have also been linked to the genetic condition.

In a handful of cases, a CGD patient may also carry another extremely rare genetic disease known as McLeod syndrome. This is due to the close proximity of genes associated with the two conditions.

7. Von Hippel–Lindau Disease

Inheritance Pattern: Autosomal dominant

von Hipple-Lindau syndrome (VHL) is a rare genetic disorder that affects multiple organ systems in our body. A person suffering from this condition usually presents with cysts and benign tumors (with the potential to transform into a malignant form) in various body parts, including the nervous system (hemangioblastomas), kidneys, uterus, and pancreas.

This condition is triggered by mutations in a particular tumor suppressor gene (located in chromosome 3) bearing an identical name. About 80% of VHL cases are inherited, while the rest are caused by ‘new’ mutations. Globally, the incidence rate of von Hippel-Lindau syndrome is about 1 in 36,000 live births.

Back in 2007, researchers at the Vanderbilt university speculated that VHL may have played a significant role in the legendary Hatfield-McCoy rivalry after some members of the McCoy blood-line have been diagnosed with von Hipple-Lindau. Pheochromocytomas (tumor in the adrenal gland), which is caused by VHL could explain their short temper, rage and violent outbursts.

6. Cryopyrin-associated Periodic Syndrome

Inheritance Pattern: Autosomal dominant

Cryopyrin-associated periodic syndrome (CAPS for short) is a group of clinically overlapping autoinflammatory diseases (faulty innate immune system) including the Muckle-Wells syndrome, neonatal-onset multisystem inflammatory disease, and familial cold autoinflammatory syndrome, all of which share the same pathology and triggered by mutations in a particular gene.

Fever is the most common symptom among CAPS patients along with fatigue, mood swings, rash, and depression. It can also cause visual and hearing impairment along with various musculoskeletal problems including arthritis and bone deformity. In extremely rare cases, CAPS can cause abnormal proteins to build in multiple organ tissues (AA amyloidosis).

Mutations in the NLRP3 gene (located in chromosome 3) is known to be the root cause of CAPS. The particular gene is responsible for encoding cryopyrin protein, an essential component of the innate immune system responsible for recognizing the pathogen-associated molecular pattern.

5. Wiskott–Aldrich Syndrome

Inheritance Pattern: X-linked recessive (both parents must be a carrier)

Wiskott-Aldrich syndrome (WAS) is a rare x-linked recessive condition that usually affects only males. The most common symptoms are small red spots on the skin (broken blood vessels) and easy bruising due to low platelet counts, dermatitis, and bloody diarrhea. Most WAS patients are likely to develop at least one autoimmune disorder and blood-related cancer.

This condition is caused by mutations in WAS gene located on the X chromosome. A couple of other rare genetic disorders have also been linked to mutations in the aforementioned gene.

Treatments for WAS are currently symptom(s) based i.e treating symptoms as they arise. Regular intravenous immunoglobulins (IVIG) and blood transfusion can help patients. In the United States, this genetic condition affects 1 in about 250,000 live births.

4. Harlequin-type ichthyosis

Harlequin fetus

Inheritance Pattern: Autosomal recessive

Harlequin-type ichthyosis or simply Harlequin ichthyosis is a life-threatening genetic condition in which infants are born with hard, diamond-shaped skin plates that are separated by large cracks. A healthy skin basically acts like a protective barrier that stops hostile microbes from entering our body while keeping important fluids inside.

The extreme skin condition in harlequin ichthyosis, however, disrupt this balance, making affected individuals maintain body temperature, water and susceptible to infections. It also limits the movement of the limbs and legs. Restricted movement of the chest can lead to breathing difficulties. Infants affected with Harlequin-type ichthyosis are likely to die within one month of their birth.

Harlequin ichthyosis is extremely rare and though its exact occurrence rate is not known, it’s estimated to affect about 1 in every 300,000 live births.

3. Tay–Sachs Disease

Inheritance Pattern: Autosomal recessive

Tay-Sachs is a fatal (in most cases) genetic disorder in which nerve cells present in the spinal cord and the brain are rapidly destroyed. This extremely rare genetic anomaly is caused by mutations in the HEXA gene located on chromosome 15.

Based on its time of onset, the disease can be classified into three types, the most common and perhaps the most lethal being infantile Tay–Sachs disease which usually starts showing signs in infants six months after their birth. Symptoms include a rapid decline in physical and mental abilities, blindness and muscle stiffness. The other two forms of Tay-Sachs are rarer and are not life-threatening.

In the United States, Tay-Sachs disease affects nearly about 1 in 320,000 individuals. However, it has an exceptionally high incidence rate among Ashkenazi Jews which is around 1 in every 3,500 live births.

2. Proteus Syndrome

Left to right: A kid with Proteus syndrome graphical illustration of the condition

Proteus syndrome is an extremely rare genetic condition that involves abnormal growth of bones, skin, blood vessels and fatty tissues. It’s progressive in nature means a person is normally born without any visible deformities. Proteus syndrome patients generally develop bone and skin tumors and have unique skeletal malformations including inconsistency in limb length and spinal deformity.

According to a study conducted in 2011, alterations in AKT1 gene (located in chromosome 14) can trigger this condition. There are just over 200 confirmed cases of Proteus syndrome worldwide, however, the number doesn’t include people who go undiagnosed.

1. Fibrodysplasia ossificans progressiva

Inheritance Pattern: Autosomal dominant

Fibrodysplasia ossificans progressiva (FOP) is perhaps one of the rarest known diseases that affect humans. It messes up the body’s skeletal repair mechanism and puts it into overdrive. The disorder causes muscles, ligaments, and tendons to slowly turn into bone (ossification). Formation of extra-skeletal bone trigger gradual loss of mobility which can lead to further complications.

People suffering from FOP are born with malformed big toes (for unknown reasons) and may also have abnormally short thumbs. The usual onset is before age of 10 when lumps started to become visible around the neck, shoulders and then spread throughout the body.

Muscle injuries, trauma or surgical attempts to remove a bone overgrowth are more likely to aggravate the situation by triggering more rapid ossification in the affected area. Due to its extreme rarity and muscle involvement, Fibrodysplasia ossificans progressiva is often misdiagnosed either as cancer or fibrosis.

Almost all known cases of FOP are caused by new mutations and are not genetically inherited. Alterations in the gene ACVR1 is understood to be the root cause of this disease.

Bipro Das

Biprojit has been a staff writer at RankRed since 2015. He mainly focuses on game-changing inventions but also covers general science with a particular interest in astronomy. His domain extends to mobile apps and knows a thing or two about finance. Biprojit has a Bachelor of Arts degree from the University of Delhi, majoring in Geography.

Σχετικά Άρθρα


Support for Families and Alzheimer's Disease Caregivers

Caring for a person with Alzheimer’s disease can have high physical, emotional, and financial costs. The demands of day-to-day care, changes in family roles, and decisions about placement in a care facility can be difficult. There are several evidence-based approaches and programs that can help, and researchers are continuing to look for new and better ways to support caregivers.

Becoming well-informed about the disease is one important long-term strategy. Programs that teach families about the various stages of Alzheimer’s and about ways to deal with difficult behaviors and other caregiving challenges can help.

Good coping skills, a strong support network, and respite care are other ways that help caregivers handle the stress of caring for a loved one with Alzheimer’s disease. For example, staying physically active provides physical and emotional benefits.

Some caregivers have found that joining a support group is a critical lifeline. These support groups allow caregivers to find respite, express concerns, share experiences, get tips, and receive emotional comfort. Many organizations sponsor in-person and online support groups, including groups for people with early-stage Alzheimer’s and their families.