Πληροφορίες

Μακροζωία και έκταση επιμόλυνσης μετά τον εμβολιασμό SARS-COV-2 με Janssen

Μακροζωία και έκταση επιμόλυνσης μετά τον εμβολιασμό SARS-COV-2 με Janssen


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Το εμβόλιο Johnson, σε αντίθεση με τα εμβόλια RNA από την Pfizer & Moderna, χρησιμοποιεί έναν φορέα που περιέχει κωδικοποίηση DNA για την πρωτεΐνη ακίδων SARS-COV-2. Αυτός ο φορέας DNA χρειάζεται να εισέλθει στο κύτταρο, επιτρέποντας τη μεταγραφή και τη μετάφραση σε πρωτεΐνες ιικής ακίδας (Εικ. 1). Αυτές οι πρωτεΐνες αιχμής εκτίθενται στη συνέχεια στην κυτταρική επιφάνεια από τα κύτταρα ξενιστές, εκθέτοντας έτσι τους αντιγονικούς επιτόπους, δημιουργώντας την ανοσοαπόκριση.

Βασικά, αυτό στρέφει τα κύτταρα του ανοσοποιητικού έναντι του ξενιστή τους, επειδή εκφράζουν ξένες πρωτεΐνες στην κυτταρική επιφάνεια. Στην πραγματικότητα, υποθέτω, αυτά τα κύτταρα ξενιστές καταστρέφονται στη συνέχεια από το ανοσοποιητικό σύστημα.

Τώρα αναρωτιόμουν αν έχει γίνει κάποια έρευνα που να αποκαλύπτει τις συνέπειες αυτής της αυτοάνοσης απάντησης. Συγκεκριμένα πόσος χρόνος χρειάζεται για να απαλλαγούμε από όλα τα επιμολυσμένα κύτταρα (ή «εμβολιασμένα κύτταρα» όπως συνηθίζουν να αποκαλούνται) και ποια είναι η έκταση (όγκος/πληγείσα περιοχή) των επιμολυσμένων κυττάρων; Βασικά, αλλάζετε γενετικά τα κύτταρα του ξενιστή που στη συνέχεια προσβάλλονται από το ανοσοποιητικό σύστημα. Οπότε με ενδιαφέρει βασικά η φαρμακοκινητική του εμβολίου υποθέτω.

Αυτή η έκθεση ασφάλειας από τον EMA λέει ότι σε 1 ζώο (από πόσα;) υπήρχε ακόμη γενετικό υλικό μετά από 180 ημέρες για ανίχνευση. Ωστόσο, η έκθεση δεν λέει τίποτα για την έκταση των επιμολυσμένων κυττάρων ούτε τίποτα για την αυτοάνοση βλάβη μετά την επίθεση του ξενιστή στα δικά του κύτταρα. Δεν υπάρχουν αναφορές ούτε. όλα φαίνεται να αφορούν εσωτερικές μελέτες ασφάλειας.

Εκ των υστέρων θα προτιμούσα να μην είχα κάνει το εμβόλιο Janssen. Στοιχηματίζω ότι τα εμβόλια mRNA είναι πολύ πιο ασταθή, διασφαλίζοντας την ασφαλή αφαίρεση του ξένου γενετικού υλικού.

Τέλος πάντων, παρασύρομαι ... Εν ολίγοις, (1) πόσος χρόνος χρειάζεται για να καθαριστούν όλα τα σημάδια ξένου DNA από τον ξενιστή μετά τον Janssen, και (2) τι είναι το έκταση των κυττάρων που επιμολύνθηκαν και στη συνέχεια επιτέθηκαν και υπέστησαν ζημιά/σκοτώθηκαν από τον οικοδεσπότη;


Εικ. 1. Σχηματική απεικόνιση του εμβολίου DNA από τον Janssen. πηγή: Livingstone et αϊ. (2021)

βιβλιογραφικές αναφορές
- Ευρωπαϊκός οργανισμός φαρμάκων, έκθεση αξιολόγησης COVID-19 Vaccine Janssen
- Λίβινγκστον et αϊ., ΤΖΑΜΑ (2021); 325(15): 1575


Τόσο τα εμβόλια AstraZeneca (AZ) όσο και Janssen (J) κατά του SARS-CoV-2 λειτουργούν χρησιμοποιώντας αυτό που είναι γνωστό ως ιικός φορέας για να δημιουργήσει μια ανοσοαπόκριση. Και στις δύο περιπτώσεις αυτά τα εμβόλια χρησιμοποιούν έναν αδενοϊό ως φορέα (ο φορέας σε αυτή την περίπτωση σημαίνει "φορέας").

Οι αδενοϊοί είναι μια οικογένεια ιών διπλού κλώνου DNA, συνηθέστερα γνωστές ως μία από τις αιτίες της ασθένειας γνωστής ως «κοινό κρυολόγημα». Υπάρχουν περίπου 88 ανθρώπινοι ορότυποι (πώς αντιδρούν τα σώματα των ανθρώπων στον ιό, διαφορετικοί ορότυποι μπορεί να μην προστατεύουν διασταυρωτικά αυξάνοντας μια ανοσολογική απόκριση) του ιού που διαιρείται σε επτά είδη: Αδενοϊούς A-G. Συνολικά υπάρχουν περίπου 50 είδη από ένα ευρύ φάσμα ζώων. Λόγω της ποικιλομορφίας και της αφθονίας του «κοινού κρυολογήματος» οι περισσότεροι άνθρωποι θα έχουν κάποια ανοσολογική απόκριση σε τουλάχιστον μερικούς από τους ανθρώπινους αδενοϊούς.

Οι αδενοϊοί είναι καλοί φορείς για εμβόλια και για άλλες θεραπευτικές χρήσεις, όπως η ογκολυτική ιική θεραπεία, επειδή τα γονιδιώματα τροποποιούνται εύκολα και μπορούν να καταστούν ανίκανα για την αναπαραγωγή πολύ εύκολα. Για να γίνει αυτό, τα βασικά γονίδια αναπαραγωγής αφαιρούνται και οι ιοί αναπαράγονται σε κύτταρα που παρέχουν τις απαραίτητες πρωτεΐνες για τον ιό να ολοκληρώσει τον κύκλο ζωής του, έτσι ώστε να λάβετε ένα ιικό σωματίδιο που δεν περιέχει πλέον το πλήρες γονιδίωμα. Αυτοί οι ιοί είναι επίσης ανεκτικοί στις προσθήκες στο γονιδίωμα, ώστε να μπορούν να χρησιμοποιηθούν για την παραγωγή πρωτεϊνών που κανονικά δεν βρίσκονται σε έναν αδενοϊό.

Από την άλλη πλευρά, το συστατικό αδενοϊού αυτών των φορέων μπορεί να προκαλέσει τη δική του ανοσοαπόκριση, μειώνοντας την αποτελεσματικότητα της ανοσοαπόκρισης σε επακόλουθα εμβόλια που αναπτύχθηκαν χρησιμοποιώντας τον ίδιο ή παρόμοιο ιό ορο-τύπου.

Το εμβόλιο AZ βασίζεται σε έναν αδενοϊό χιμπατζή. Το εμβόλιο J από την άλλη πλευρά βασίζεται στον ορότυπο 26 (Ad26) των ανθρώπινων αδενοϊών. Και στις δύο περιπτώσεις ο αδενοϊός καθίσταται αναπαραγωγικός ανίκανος με την αφαίρεση των βασικών γονιδίων αντιγραφής.

Για να λειτουργήσουν οι αδενοϊοί ως εμβόλια, πρέπει να εισβάλουν σε ένα κύτταρο και στη συνέχεια να εισάγουν το DNA τους στον πυρήνα (όπως φαίνεται στο διάγραμμα από το OP), όπου οι κυτταρικοί μηχανισμοί παράγουν πολλά αντίγραφα mRNA του γονιδίου (ες) και ταυτόχρονα παράγουν πρωτεΐνες από αυτά mRNA. Αυτές οι πρωτεΐνες στη συνέχεια μετατοπίζονται στην επιφάνεια του κυττάρου (αυτή είναι μια φυσική διαδικασία).

Ωστόσο, κατά τη διαδικασία τα ιικά DNA και οι πρωτεΐνες αναγνωρίζονται από το κύτταρο ως μη εαυτά και ενεργοποιούν το έμφυτο ανοσοποιητικό σύστημα προκαλώντας παρουσίαση αντιγόνου και ενεργοποίηση του προσαρμοστικού ανοσοποιητικού συστήματος. Όλη αυτή η διαδικασία είναι μια φυσική απάντηση του σώματος στη μόλυνση και δεν καταλήγει σε «αυτοαναγνώριση», οπότε δεν υπάρχει αυτοάνοση απάντηση στις κυτταρικές πρωτεΐνες.

Τόσο το εμβόλιο AZ όσο και το εμβόλιο J χορηγούνται ενδομυϊκά, κάτι που είναι πολύ χαρακτηριστικό για τα εμβόλια. Η ενδομυϊκή ένεση είναι ένα καλό σημείο για ένεση επειδή μπορεί να ανεχθεί μεγάλο όγκο και έχει σχετικά υψηλή ροή αίματος (και τα δύο σε σύγκριση με την υποδόρια (υποδερμίδα)). Ωστόσο, από τη στιγμή που εγχυθεί ο ιός δεν παραμένει απαραίτητα στον μυ, μπορεί να ταξιδέψει στο αίμα και ένα μέρος θα καταλήξει σε άλλες θέσεις, ιδιαίτερα στο ήπαρ και τις κυψελίδες του πνεύμονα (μέρη όπου υπάρχει μεγάλη παροχή αίματος και πολλά των μικρών αιμοφόρων αγγείων). Ο αδενοϊός μπορεί να μολύνει οποιοδήποτε κύτταρο που εκφράζει τον κυτταρικό υποδοχέα που ονομάζεται Coxsackievirus και υποδοχέας αδενοϊού (CAR) στην επιφάνειά του, ο οποίος περιλαμβάνει κύτταρα του ανοσοποιητικού. Υπάρχει μια αρκετά ολοκληρωμένη ανασκόπηση όλων των μηχανισμών και των τύπων κυττάρων εδώ, αλλά είναι γραμμένη για τον επιστήμονα. Ακολουθεί ένα κατάλληλο απόσπασμα για τους τύπους κυττάρων:

Οι τύποι κυττάρων υπάρχουν όταν χορηγείται εμβόλιο i.m. περιλαμβάνουν μυοκύτταρα, σκελετικά μυϊκά κύτταρα, ινοβλάστες και ενδοθηλιακά κύτταρα, με τα APC όπως DCs ή μακροφάγα να αντιπροσωπεύουν μια μειοψηφία σε σύγκριση με την αφθονία των σκελετικών μυϊκών κυττάρων ποντικού

Το πόσο καιρό παραμένει το γονιδίωμα του ιού εξαρτάται από το χαρτί, αλλά δεν έχουν ψάξει πολλοί άνθρωποι. Τα δεδομένα που μπόρεσα να βρω φαίνεται να δείχνουν ότι η περισσότερη έκφραση πρωτεΐνης χάνεται μετά από περίπου 3 εβδομάδες, αλλά μπορεί να επιμείνει περισσότερο. π.χ.:

Αν και η έκφραση Ag δεν μπορούσε πλέον να ανιχνευθεί 3 εβδομάδες μετά την ανοσοποίηση, η εξέταση της παρουσίας Ag στους λεμφαδένες αποστράγγισης έδειξε ότι τα APC φορτώθηκαν με πεπτίδιο Ag για τουλάχιστον 40 ημέρες μετά την ανοσοποίηση, υποδηλώνοντας ότι το Ag παραμένει διαθέσιμο στο σύστημα για παρατεταμένη περίοδο. αν και η ακριβής πηγή αυτού του Ag μένει να προσδιοριστεί.

Ωστόσο, τα γονιδιώματα φαίνεται να επιμένουν για πολύ μεγάλο χρονικό διάστημα, ίσως όσο και ένα χρόνο ή περισσότερο:

Μέχρι τις ημέρες 30 και 90, οι αλληλουχίες φορέων παρέμειναν ανιχνεύσιμες στα περισσότερα ζώα σε αυτούς τους ιστούς, αλλά σταδιακά μειώθηκαν 102 έως 103 φορές. Μετά από 1 χρόνο, οι σχετικοί αριθμοί αντιγράφων στο ήπαρ και οι μύες που εγχύθηκαν ήταν συγκρίσιμοι με αυτούς που παρατηρήθηκαν την ημέρα 90, ενώ μια περαιτέρω μείωση παρατηρήθηκε στους σπλήνες.

Σημειώστε ότι και τα δύο παραπάνω αποσπάσματα δεν αφορούν ούτε τα εμβόλια Janssen ούτε τα AZ, αλλά γενικά εμβόλια για τον αδενοϊό, και πολλά Ad vectors δοκιμάστηκαν και στα δύο. Είναι πολύ πιθανό τα εμβόλια AZ και J να έχουν παρόμοια δεδομένα.

Επεξεργάστηκε για να προσθέσει: Δεν ξέρω γιατί το DNA παραμένει για τόσο μεγάλο χρονικό διάστημα, αλλά δεν ενσωματώνεται στο γονιδίωμά μας. Φαίνεται ότι οι περισσότεροι ανεπαρκείς αναπαραγωγικοί αδενοϊοί στερούνται του γονιδίου Ε1Α, το οποίο επιτρέπει την επαγωγή του κυτταρικού κύκλου και απελευθερώνει πόρους για αντιγραφή του ιού. Ωστόσο, τα γονίδια που εμπλέκονται στην αντιγραφή του ιικού DNA είναι τα Ε2Α και Ε2Β, επομένως δεν περιλαμβάνονται στη διαγραφή.

TLDR: Το γονιδίωμα του ιού μπορεί να επιμένει για πολύ μεγάλο χρονικό διάστημα, αλλά η έκφραση πρωτεΐνης όχι - πιθανώς επειδή το ανοσοποιητικό σύστημα το αντιμετωπίζει γρήγορα μετά από μερικές εβδομάδες (αποτελεσματικός εμβολιασμός…). Οι φορείς μπορούν να φτάσουν και να μολύνουν πολλούς ιστούς στο σώμα, ιδιαίτερα αυτούς με υψηλή ροή αίματος και πολλά μικρά αιμοφόρα αγγεία όπως οι πνεύμονες και το συκώτι.


5 Γεγονότα για τον Johnson & amp Johnson’s Investigational Janssen Covid-19 Vaccine Candidate

τον Ιανουάριο του 2020, ακριβώς όταν ο SARS-CoV-2, που προκαλεί τον COVID-19, άρχισε να εξαπλώνεται σε όλο τον κόσμο, οι φαρμακευτικές εταιρείες Janssen της Johnson & amp Johnson άρχισαν να ερευνούν πιθανούς υποψήφιους εμβολιασμούς.

επεκτείνουν

Μια κοντινή άποψη του SARS-CoV-2

Τρεις μήνες αργότερα, οι επιστήμονες της εταιρείας ανακοίνωσαν έναν κύριο υποψήφιο εμβόλιο σε εξέλιξη στο Janssen και τα σχέδιά του να το θέσουν σε κλινική δοκιμή φάσης 1/2a σε ανθρώπους το αργότερο έως τον Σεπτέμβριο του 2020 - χρονοδιάγραμμα που, τον Ιούνιο, η εταιρεία ανακοίνωσε ότι θα βραχύνω.

Τον Ιούλιο, δεδομένα που δημοσιεύθηκαν στο Nature έδειξαν ότι το ερευνητικό εμβόλιο του Janssen προκάλεσε μια ανοσολογική απόκριση κατά του SARS-CoV-2 σε μια προκλινική, μη ανθρώπινη μελέτη.

Με βάση τα θετικά δεδομένα από αυτήν την προκλινική μελέτη, η οποία διεξήχθη σε συνεργασία με ερευνητές από το Ιατρικό Κέντρο Beth Israel Deaconess, οι πρώτες δοκιμές σε ανθρώπους του πιθανού εμβολίου ξεκίνησαν τον Ιούλιο.*

«Είμαστε ενθουσιασμένοι που είδαμε αυτά τα προκλινικά δεδομένα επειδή έδειξαν ότι το υποψήφιο εμβόλιο μας για τον COVID-19 δημιούργησε μια ισχυρή απόκριση αντισωμάτων και παρείχε προστασία με μία μόνο δόση», λέει ο Paul Stoffels, M.D. Paul Stoffels, M.D., Αντιπρόεδρος της Εκτελεστικής Επιτροπής και Γενικός Επιστημονικός Διευθυντής, Johnson & amp Johnson, Αντιπρόεδρος της Εκτελεστικής Επιτροπής και Επικεφαλής Επιστημονικός Διευθυντής, Johnson & amp Johnson. «Τα ευρήματα μας δίνουν αυτοπεποίθηση καθώς προχωράμε παράλληλα στην ανάπτυξη εμβολίων και στην πολυτελή παραγωγή μας».

Στις 23 Σεπτεμβρίου, η Johnson & Johnson ανακοίνωσε ότι ξεκίνησε μια κλινική δοκιμή Φάσης 3 σε πολλές χώρες για να αξιολογήσει περαιτέρω την ασφάλεια και την αποτελεσματικότητα του υποψήφιου εμβολίου της Janssen για τον COVID-19.**

Τον Δεκέμβριο του 2020, η δοκιμή Φάσης 3, γνωστή ως ENSEMBLE, έφτασε σε πλήρη εγγραφή με περίπου 45.000 ενήλικες συμμετέχοντες.

Η Johnson & amp Johnson αναπτύσσει όλη την επιστήμη, την κλίμακα και την τεχνογνωσία της για να βοηθήσει στην καταπολέμηση της πανδημίας, καθώς ο COVID-19 συνεχίζει να επηρεάζει ανθρώπους και κοινότητες σε όλο τον κόσμο-σύμφωνα με τον Παγκόσμιο Οργανισμό Υγείας, από αυτόν τον μήνα, τα παγκόσμια κρούσματα έχουν πλέον ξεπέρασε τα 80 εκατομμύρια.

Διαβάστε παρακάτω για να μάθετε τα τελευταία στοιχεία σχετικά με τον ερευνητικό υποψήφιο εμβόλιο του Janssen για το COVID-19.


Το εμβόλιο Pfizer, Biontech Covid-19 χρησιμοποιεί τεχνολογία που θα μπορούσε να φέρει επανάσταση στους μελλοντικούς εμβολιασμούς

Την περασμένη εβδομάδα, η Pfizer δημοσίευσε προκαταρκτικά ευρήματα που έδειξαν ότι ο υποψήφιος για εμβόλιο είναι περισσότερο από 90 τοις εκατό αποτελεσματικός στην πρόληψη του συμπτωματικού Covid-19. Τη Δευτέρα, η Moderna πρόσθεσε τα ενθαρρυντικά νέα, με τα πρώτα αποτελέσματα από τη δοκιμή της Φάσης 3 να δείχνουν ότι το πειραματικό της εμβόλιο είναι 94,5 % αποτελεσματικό στην πρόληψη της ασθένειας. Το να βλέπεις τέτοια σταθερά αποτελέσματα σε αυτό το στάδιο των δοκιμών είναι ένα καλό σημάδι, είπε ο del Rio.

"Αυτό με κάνει να αισθάνομαι ότι," καλά, η Pfizer δεν ήταν τυχαία ", είπε. «Αυτό είναι στην πραγματικότητα. Αυτό λειτουργεί πραγματικά ».

Αν και καθησυχαστικά, τα αποτελέσματα είναι ακόμα προκαταρκτικά-τα πλήρη αποτελέσματα της μελέτης δεν έχουν ακόμη δημοσιευτεί σε περιοδικό με κριτές από άλλους επιστήμονες για να ελέγξουν-και δεν είναι ακόμη γνωστό πόσο καιρό τα εμβόλια θα μπορούσαν να προσφέρουν προστασία ή αν θα έχουν καλή απόδοση όλες τις ηλικιακές ομάδες και τις εθνότητες.

Μία από τις κύριες διαφορές μεταξύ των δύο υποψηφίων εμβολίων είναι ο τρόπος αποθήκευσης τους. Και οι δύο απαιτούν δύο δόσεις, αλλά το εμβόλιο της Pfizer πρέπει να φυλάσσεται σε θερμοκρασίες μείον 94 βαθμών Φαρενάιτ ή χαμηλότερες, γεγονός που έχει εγείρει πρακτικές ανησυχίες σχετικά με το πώς θα μπορούσαν να αποσταλούν και να διαδοθούν. Το εμβόλιο της Moderna δεν απαιτεί αποθήκευση σε υπερψύξη και μπορεί να παραμείνει σταθερό σε κανονικά επίπεδα ψύξης - μεταξύ περίπου 36 και 46 βαθμών Φαρενάιτ - για 30 ημέρες.

Αυτή η διάκριση οφείλεται πιθανώς στον τρόπο συσκευασίας του συνθετικού mRNA των εμβολίων, ή του αγγελιοφόρου RNA, σύμφωνα με την Paula Cannon, αναπληρώτρια καθηγήτρια μικροβιολογίας στο Ιατρικό Σχολείο Keck του Πανεπιστημίου της Νότιας Καλιφόρνιας. Από μόνο του, το mRNA είναι ένα εύθραυστο μόριο, πράγμα που σημαίνει ότι πρέπει να επικαλυφθεί με προστατευτικό, λιπαρό κάλυμμα για να διατηρηθεί σταθερό.

Οι συνθήκες ψύξης μπορεί να έχουν να κάνουν με το πώς κατασκευάστηκε και σταθεροποιήθηκε το mRNA, είπε ο Cannon, αν και αυτές οι ακριβείς λεπτομέρειες είναι αποκλειστικές των εταιρειών.

Ο Dr Drew Weissman, καθηγητής ιατρικής στο University of Pennsylvania Perelman School of Medicine, υπήρξε πρώτος πρωτοπόρος στην έρευνα εμβολίων mRNA και τώρα συνεργάζεται με την BioNTech, μια γερμανική εταιρεία βιοτεχνολογίας που έχει συνεργαστεί με την Pfizer. Είπε ότι συνεχίζονται οι εργασίες για την ενίσχυση του πειραματικού εμβολίου - συμπεριλαμβανομένων βελτιώσεων στις απαιτήσεις αποθήκευσης.

«Υπάρχουν σίγουρα βελτιώσεις που ήδη αναπτύσσονται», είπε.

Τόσο το εμβόλιο Pfizer όσο και το εμβόλιο Moderna κατασκευάζονται χρησιμοποιώντας συνθετικό αγγελιοφόρο RNA. Σε αντίθεση με το DNA, το οποίο μεταφέρει γενετικές πληροφορίες για κάθε κύτταρο του ανθρώπινου σώματος, το αγγελιοφόρο RNA κατευθύνει την παραγωγή πρωτεΐνης του σώματος με πολύ πιο εστιασμένο τρόπο.

"Όταν ένα συγκεκριμένο γονίδιο πρέπει να κάνει τη δουλειά του, δημιουργεί ένα αντίγραφο του εαυτού του, το οποίο ονομάζεται αγγελιοφόρο RNA", δήλωσε ο Cannon. "Εάν το DNA είναι το μεγάλο εγχειρίδιο οδηγιών για το κύτταρο, τότε το RNA του αγγελιοφόρου είναι σαν να φωτοτυπείτε μόνο μία σελίδα που χρειάζεστε και να την μεταφέρετε στο εργαστήριό σας."

Το εμβόλιο Pfizer και το εμβόλιο Moderna χρησιμοποιούν συνθετικό mRNA που περιέχει πληροφορίες σχετικά με την υπογεγραμμένη πρωτεΐνη του κορονοϊού. Τα εμβόλια ουσιαστικά λειτουργούν υποκρύπτοντας οδηγίες που κατευθύνουν το σώμα να παράγει μια μικρή ποσότητα πρωτεΐνης αιχμής. Μόλις το ανοσοποιητικό σύστημα ανιχνεύσει αυτήν την πρωτεΐνη, το σώμα στη συνέχεια αρχίζει να παράγει προστατευτικά αντισώματα.

"Αυτά τα αντισώματα θα λειτουργήσουν όχι μόνο ενάντια στην μικρή ποσότητα πρωτεΐνης που δημιουργήθηκε μετά τον εμβολιασμό, αλλά θα αναγνωρίσουν και θα σταματήσουν τον κορωνοϊό να εισχωρήσει στα κύτταρά μας εάν εκτεθούμε στο μέλλον", δήλωσε ο Cannon. «Είναι πραγματικά ένα έξυπνο κόλπο».

Αλλά όσο κομψός είναι αυτός ο μηχανισμός στη θεωρία, τα εμβόλια mRNA έχουν αντιμετωπίσει πραγματικές βιολογικές προκλήσεις από τότε που αναπτύχθηκαν για πρώτη φορά τη δεκαετία του 1990. Σε πρώιμες μελέτες σε ζώα, για παράδειγμα, τα εμβόλια προκάλεσαν ανησυχητική φλεγμονή.

«Αυτό έγινε ένα από τα μεγάλα ερωτήματα: Πώς το παίρνετε αυτό μέσα στο σώμα χωρίς να δημιουργήσετε φλεγμονώδη αντίδραση;» δήλωσε ο Norman Baylor, πρόεδρος και διευθύνων σύμβουλος της Biologics Consulting και πρώην διευθυντής του Γραφείου Έρευνας και Επισκόπησης Εμβολίων του FDA.

Παρόλο που καμία από τις δύο εταιρείες δεν έχει αναφέρει σοβαρά προβλήματα ασφαλείας μέχρι στιγμής, οι επιστήμονες θα συνεχίσουν να παρακολουθούν τους συμμετέχοντες και στις δύο δοκιμές με την πάροδο του χρόνου.

«Υπάρχει πάντα μια ανησυχία όταν προσπαθείτε να ξεγελάσετε το ανοσοποιητικό σύστημα - κάτι που κάνει το εμβόλιο - ότι θα μπορούσατε να έχετε ακούσιες παρενέργειες», είπε ο Cannon. «Το ανοσοποιητικό σύστημα είναι απίστευτα περίπλοκο και διαφέρει από άτομο σε άτομο».


Μπορεί η τεχνολογία να μας βοηθήσει να κερδίσουμε τον αγώνα εμβολίων κατά του COVID-19;

Η πρωτοφανής αποφασιστικότητα και η ταχύτητα με την οποία αναπτύχθηκαν και εγκρίθηκαν τα εμβόλια COVID-19 ήταν εντυπωσιακά στο ελάχιστο. Ωστόσο, η επιτυχία έχει προκαλέσει κάποια ανησυχία σχετικά με την ασυνήθιστα γρήγορη διαδικασία ανάπτυξης εμβολίου. Μπορούν τα εμβόλια που αναπτύσσονται τόσο γρήγορα να είναι ασφαλή;

Αυτό ήταν ένα ερώτημα που συχνά τίθεται δημόσια. Χρειάστηκε μεγάλη προσπάθεια από την επιστημονική κοινότητα για να πειστούν οι αμφίβολοι ότι δεν είχαν κοπεί γωνίες και δεν είχαν παραμεληθεί καμία μέτρηση ασφάλειας και η επιταχυνόμενη ανάπτυξη του εμβολίου οφείλεται σε άριστες συνεργασίες μεταξύ ακαδημαϊκών ιδρυμάτων, φαρμακευτικών και βιοτεχνολογικών εταιρειών και κυβερνητικών οργανισμών. Η τεχνολογία έπαιξε επίσης βασικό ρόλο και παρόλο που η προσέγγιση εμβολίου που βασίζεται σε RNA παρουσιάστηκε ως μια νέα τεχνολογία παντού, υπάρχει από το 1989 [1], αλλά η υπόσχεσή της εκπληρώθηκε μόνο με πρόσφατες ανακαλύψεις στη μηχανική και την παράδοση RNA.

Οι συνεργάτες μας θα συζητήσουν την ανάπτυξη εμβολίων, αντιμετωπίζοντας άγνωστα στην ανοσολογική απόκριση και αξιοποιώντας το ανοσοποιητικό σύστημα στη θεραπεία ασθενειών.

Η κοινή γνώμη έχει ζωγραφίσει την εικόνα της απερισκεψίας, αλλά στην πραγματικότητα ο μόνος κίνδυνος που αναλήφθηκε κατά τη διαδικασία ανάπτυξης του εμβολίου σχετίζεται με την παραγωγή εμβολίου, η οποία ξεκίνησε πριν από τη διάθεση των αποτελεσμάτων από την κλινική αξιολόγηση και τη λήψη έγκρισης φαρμάκου. Γενικά, η παραγωγή ξεκινά μόνο αφού το υποψήφιο εμβόλιο έχει εγκριθεί από αρχές όπως ο FDA ή ο EMA. Ωστόσο, σε αυτή την περίπτωση η παραγωγή ξεκίνησε ενώ οι υποψήφιοι εμβολίων αξιολογήθηκαν σε κλινικές δοκιμές φάσης ΙΙΙ, οι οποίες παρείχαν μια πρώτη αρχή για τη διανομή και τη χορήγηση του εμβολίου μόλις ελήφθη η άδεια. Αυτό ήταν προφανώς μεγάλος κίνδυνος, καθώς δεν υπήρχε καμία εγγύηση ότι το εμβόλιο ήταν αποτελεσματικό ενώ ήταν ήδη σε παραγωγή. Ευτυχώς, οι κλινικές μελέτες έδωσαν ευνοϊκά αποτελέσματα και τα εμβόλια που βασίζονται σε RNA και αδενοϊό έχουν εγκριθεί σε πολλές χώρες. Μαζικοί εμβολιασμοί σε όλο τον κόσμο επιβεβαίωσαν περαιτέρω ότι τα εμβόλια για τον COVID-19 ήταν ασφαλή και δόθηκε μεγάλη ελπίδα στην αποτελεσματικότητά τους επιτρέποντας στη ζωή να επιστρέψει στο φυσιολογικό, όπως το γνωρίζαμε πριν από την πανδημία.

Στη συνέχεια, έφτασαν τα ανησυχητικά νέα για τις νέες παραλλαγές του SARS-CoV-2, οι οποίες θεωρήθηκε ότι έδειχναν υψηλότερα ποσοστά μετάδοσης και ενισχυμένη παθογένεια [2]. Readyδη εξαντλημένοι από τις επιπτώσεις της πανδημίας για περισσότερο από ένα χρόνο, με περισσότερα από 122 εκατομμύρια μολυσμένα άτομα και 2,7 εκατομμύρια θανάτους παγκοσμίως και μια παγκόσμια οικονομία να έχει υποστεί σοβαρές ζημιές, οι άνθρωποι άρχισαν να ρωτούν αν υπάρχει διέξοδος από αυτό - επιστήμη και η τεχνολογία έρχεται να μας βοηθήσει; Μπορεί η τεχνολογία να μας βοηθήσει να κερδίσουμε τον αγώνα κατά του COVID-19;

Η επιστήμη και η τεχνολογία έχουν παίξει καθοριστικούς ρόλους σε όλα τα επίπεδα της μεταφραστικής ιατρικής που σχετίζονται με την πανδημία του COVID-19. Οι επιστημονικές ανακαλύψεις και η τεχνολογική ανάπτυξη διευκόλυναν τη διάγνωση της πανδημίας, συμπεριλαμβανομένων ταχείων τεχνολογιών PCR, δοκιμών αντισωμάτων και μεθόδων αλληλουχίας επόμενης γενιάς (N G S) για την κατανόηση της προέλευσης του SARS-CoV-2 [3, 4]. Η ανάπτυξη του εμβολίου βασίζεται σε μεγάλο βαθμό στην τεχνολογία, από τα δεδομένα αρχικής αλληλουχίας για το γονιδίωμα του SARS-CoV-2 και τη βιοπληροφορική, τις υπολογιστικές προσεγγίσεις και τη δομική μοντελοποίηση για τον εντοπισμό κατάλληλων στόχων αντιγόνων. Οι μέθοδοι που σχετίζονται με την παραγωγή αντιγόνου με τη μορφή ανασυνδυασμένων πρωτεϊνών, πεπτιδίων, ιικών φορέων ή νουκλεϊκών οξέων αντιπροσωπεύουν βασικά πλεονεκτήματα για την επιτυχία. Η παράδοση εμβολίου περιλαμβάνει μια περιοχή τεράστιας σημασίας και παρόλο που οι περισσότεροι υποψήφιοι για εμβόλια έχουν χορηγηθεί ενδομυϊκά, η μεγάλη τεχνολογική ανάπτυξη έχει αφιερωθεί στη βελτιστοποίηση της παράδοσης με τη μορφή καινοτόμων καινοτόμων συσκευών και επίσης στην εύρεση εναλλακτικών οδών όπως η ενδορινική χορήγηση μέσω εφαρμογής σκευασμάτων ψεκασμού.

Μια άλλη πτυχή της χορήγησης εμβολίου, ειδικά για εμβόλια με βάση νουκλεϊκό οξύ, σχετίζεται με την εφαρμογή νανοσωματιδίων για τη βελτίωση και τη στόχευση της παροχής, αλλά επίσης ιδιαίτερα στην περίπτωση του RNA για την παροχή προστασίας έναντι της αποδόμησης και την πρόληψη της απώλειας παραγωγής αντιγόνου στα κύτταρα ξενιστές.Εκμεταλλευόμενοι τις καινοτόμες τεχνολογίες, τόσο τα εμβόλια COVID-19 που βασίζονται σε αδενοϊούς όσο και τα βασισμένα σε RNA έχουν επιδείξει αποτελεσματικότητα άνω του 90% σε μεγάλες κλινικές δοκιμές [5]. Ωστόσο, υπάρχουν ακόμη αναπάντητα ερωτήματα και σαφείς τομείς πιθανών βελτιώσεων:

  • Πόσο αποτελεσματικά είναι τα εμβόλια στους ηλικιωμένους και ιδιαίτερα στα παιδιά;
  • Πόσο διαρκεί η διάρκεια της προστατευτικής ανοσίας από τα εμβόλια;
  • Παράγοντες όπως η φυλή, το φύλο, η γενετική, οι προϋπάρχουσες καταστάσεις και άλλοι παράγοντες επηρεάζουν την αποτελεσματικότητα του εμβολίου;
  • Είναι απαραίτητη η στρατηγική εμβολιασμού πρώτης ώθησης ή αρκεί ένας μόνο εμβολιασμός για αποτελεσματικότητα;
  • Μπορούν τα υποψήφια εμβόλια να αναμειχθούν και να συνδυαστούν για να παρέχουν συνεργιστικά αποτελέσματα;
  • Πώς μπορεί να βελτιωθεί η σταθερότητα, ειδικά για τα εμβόλια που βασίζονται σε RNA, για να διευκολυνθεί η αποθήκευση και η μεταφορά των εμβολίων;
  • Πώς πρέπει να αντιμετωπίσουμε τις υπάρχουσες και αναδυόμενες μεταλλάξεις και παραλλαγές του SARS-CoV-2;
  • Πώς μπορούμε να προετοιμαστούμε για πιθανές αναδυόμενες πανδημίες;

Για να μάθετε την αποτελεσματικότητα των εμβολίων σε ηλικιωμένους και παιδιά, οι κλινικές δοκιμές στις σχετικές ηλικιακές ομάδες θα δώσουν άμεσα την απάντηση. Για παράδειγμα, το εμβόλιο ChAdOx1 nC oV -19 που βασίζεται σε αδενοϊό χιμπατζή έχει υποβληθεί σε κλινική δοκιμή φάσης ΙΙΙ σε ηλικιωμένα άτομα [6]. Επιπλέον, καθώς οι μαζικοί εμβολιασμοί έχουν στοχεύσει τους ηλικιωμένους και τους εργαζόμενους στον τομέα της υγειονομικής περίθαλψης στην πρώτη φάση, σύντομα θα είναι διαθέσιμες πληροφορίες σχετικά με την αποτελεσματικότητα του εμβολίου. Κλινικές μελέτες έχουν επίσης προγραμματιστεί για παιδιά ηλικίας έως 6 ετών.

Η διάρκεια της προστατευτικής ανοσίας των υπαρχόντων εμβολίων θα καθοριστεί από την ανάλυση των παγκόσμιων μαζικών εμβολιασμών. Καθώς έχουν χορηγηθεί περισσότερες από 3 45 εκατομμύρια δόσεις και 101 εκατομμύρια άνθρωποι έχουν εμβολιαστεί πλήρως σε όλο τον κόσμο (από τις 21 Μαρτίου 2021), θα υπάρχουν πολλά δεδομένα για να τα αφομοιώσουν οι επιδημιολόγοι με τον καιρό. Προφανώς, δεδομένα από κλινικές δοκιμές που ξεκίνησαν το 2020 θα παρέχουν πρόσθετες πληροφορίες. Η επίδραση του άσου, του φύλου, της γενετικής, των προϋπαρχουσών συνθηκών και άλλων παραγόντων θα υποβληθεί επίσης σε επιστημονική αξιολόγηση με τη χρήση διαφόρων εργαλείων στη βιοπληροφορική, τη γονιδιωματική, την πρωτεομική, την ιατρική και την επιδημιολογία σε μεγάλο πληθυσμό εμβολιασμένων ατόμων.

Τα σημεία που εξετάστηκαν παραπάνω περιλαμβάνουν ευθεία – ανάλυση δεδομένων και βασίζονται σε μεγάλο βαθμό στις υπάρχουσες τεχνολογίες. Ωστόσο, τα υπόλοιπα τεύχη μπορούν επιπλέον να επωφεληθούν από νέες καινοτομίες. Για παράδειγμα, το ζήτημα των θεραπειών πρώτης ώθησης, όπου δύο εμβολιασμοί πραγματοποιούνται σε διαστήματα δύο ή αρκετών εβδομάδων έχει αντικατασταθεί από μία μόνο ανοσοποίηση με υποψήφιο εμβόλιο με βάση αδενοϊό (NCT04526990). Εκτός από την εφαρμογή αυτής της προσέγγισης φορέα αδενοϊού, η περαιτέρω ανάπτυξη πιο σταθερών εμβολίων με βάση το RNA και η χρήση φορέων του ιού RNA που αυτοενισχύονται μπορεί να παράσχουν την τεχνολογία που θα επιτρέπει ικανές ανοσολογικές αποκρίσεις μετά από μία μόνο χορήγηση εμβολίου. Η προσέγγιση της ανάμειξης και αντιστοίχισης των υποψηφίων για εμβόλια COVID-19 είναι ήδη σε πλήρη εξέλιξη [5]. Για παράδειγμα, υπάρχουν σχέδια για την αξιολόγηση του συνδυασμού του εμβολίου ChAdOx1 nCoV-19 και του ρωσικού εμβολίου Sputnik V με βάση τους φορείς αδενοϊού Ad26/Ad5 σε κλινικό περιβάλλον. Ομοίως, σχεδιάζεται για αξιολόγηση σε ανθρώπους ένα σχήμα αρχικής ενίσχυσης για το ChAdOx1 nCoV-19 και το εμβόλιο λιπιδικού νανοσωματιδίου (LNP)-mRNA BNT162b 2 [7]. Επιπλέον, δεδομένα από μια στρατηγική ετερόλογου εμβολιασμού σε ποντίκια που αποτελείται από ένα αυτοενισχυόμενο εμβόλιο βασισμένο σε φορέα RNA και το ChAdOx1 nCoV-19 προκάλεσαν κυρίαρχα αποκρίσεις κυτταροτοξικών Τ κυττάρων και Th1 + T κυττάρων ανώτερη από κάθε ομόλογο εμβολιασμό μόνο [8].

Η σταθερότητα και η παροχή του RNA είναι ζητήματα που πρέπει να αντιμετωπιστούν, τα οποία θα μπορούσαν να βελτιώσουν την αποτελεσματικότητα του εμβολίου και να χαλαρώσουν τις απαιτήσεις αποθήκευσης και μεταφοράς. Η ανάπτυξη της τεχνολογίας μπορεί να παίξει καθοριστικό ρόλο σε δύο επίπεδα. Πρώτον, η σταθερότητα του RNA μπορεί να βελτιωθεί με την κατασκευή διαφόρων αλληλουχιών RNA. Οι τροποποιήσεις που έγιναν στις αμετάφραστες περιοχές του 5' και 3' άκρου του mRNA και της ουράς πολυ(Α) έχουν ενισχύσει τόσο τη σταθερότητα του RNA όσο και την αποτελεσματικότητα της μετάφρασης. Επιπλέον, η βελτιστοποίηση κωδικονίων και η ενσωμάτωση αναλόγων ψευδουριδίνης έχουν προσφέρει θετική επίδραση στη σταθερότητα και τη μετάφραση του mRNA, με αποτέλεσμα ενισχυμένες ανοσοαποκρίσεις. Η ενθυλάκωση του mRNA στόχου σε LNPs έχει διευκολύνει την κυτταρική παράδοση και προστατεύει από την πρόωρη αποικοδόμηση του RNA. Παρόλο που αυτές οι τεχνολογίες έχουν εφαρμοστεί για τα υπάρχοντα εμβόλια COVID-19 με βάση το RNA, θα πρέπει να ληφθούν υπόψη περαιτέρω προσπάθειες μηχανικής.

Τα προβλήματα που αντιμετωπίστηκαν με την ανάγκη για συνθήκες χαμηλής (-20 ° C) έως πολύ χαμηλής (-80 ° C) αποθήκευσης και μεταφοράς εμβολίων που βασίζονται σε RNA έχουν προκαλέσει την αναζήτηση μεθόδων για τη βελτίωση της σταθερότητας του εμβολίου και την αποθήκευση σε περισσότερους χρήστες. φιλικές θερμοκρασίες. Σε αυτό το πλαίσιο, αν και η προσθήκη αιθανόλης θα μπορούσε να αποκαταστήσει τη συσσωμάτωση και την απώλεια της αποτελεσματικότητας των LNP που υποβλήθηκαν σε κύκλους κατάψυξης - απόψυξης, η προσέγγιση δεν ήταν πρακτική καθώς τα διαλύματα LNP έπρεπε να υποβληθούν σε διαπίδυση πριν από τη χρήση [9]. Ωστόσο, η προσθήκη τρεχαλόζης ή σακχαρόζης σε διαλύματα LNP πριν από τη λυοφιλίωση επέτρεψε την αποθήκευση σε θερμοκρασία δωματίου και την ανασύσταση σε υδατικό ρυθμιστικό χωρίς να επηρεάζεται η ισχύς χορήγησης. Αυτό θα μπορούσε να παρουσιάσει μια λύση για νέα υποψήφια εμβόλια LNP-mRNA.

Στο πλαίσιο των παραλλαγών SARS-CoV-2, μπορούν να ληφθούν σημαντικές πληροφορίες για ήδη υπάρχοντες και αναδυόμενους μεταλλάκτες από το N G S και την υπολογιστική βιολογία με τη μορφή δεδομένων αλληλουχίας και σε πυρίτιο μοντέλα για την αξιολόγηση της αποτελεσματικότητας των υπαρχόντων εμβολίων, αντίστοιχα [2]. Οι προσεγγίσεις που βασίζονται στη δομή μπορούν να παρέχουν χρήσιμες πληροφορίες για το σχεδιασμό νέων εμβολίων που στοχεύουν υπάρχοντα και αναδυόμενα μεταλλάγματα, τα οποία έχει προβλεφθεί ή αποδειχθεί ότι μειώνουν την αποτελεσματικότητα των υπαρχόντων εμβολίων. Τα εμβόλια με βάση το νουκλεϊνικό οξύ μπορούν να υποβληθούν γρήγορα σε τροποποιήσεις πιο αποτελεσματικών προσαρμοσμένων εκδόσεων για να στοχεύσουν συγκεκριμένα τις παραλλαγές του SARS-CoV-2 [10]. Οι σύγχρονες τεχνολογίες θα πρέπει επίσης να επικεντρωθούν στον σχεδιασμό των εμβολίων για τον κορωνοϊό, τα οποία μπορούν να παρέχουν ευρύτερο φάσμα προστασίας από τις τρέχουσες και μελλοντικές παραλλαγές και να είναι καλύτερα προετοιμασμένα για πιθανές αναδυόμενες εστίες και να τα αποτρέψουν από το να φτάσουν σε επίπεδα πανδημίας. Παρόλο που άλλοι παράγοντες που σχετίζονται με τον καλύτερο έλεγχο της φροντίδας των ζώων, την πρόληψη του παράνομου εμπορίου ζώων, την επανεξέταση των ταξιδιωτικών πολιτικών και την καλύτερη υγιεινή είναι σημαντικοί στην καταπολέμηση των πανδημιών, η κατάλληλη και αποτελεσματική ανάπτυξη και εφαρμογή καινοτόμων τεχνολογιών θα συμβάλει σίγουρα στην ικανότητα να ξεπεραστούν Πανδημία covid19.


ΤΕΡΑΣΤΙΚΕΣ ΠΟΣΟΤΗΤΕΣ ΔΕΔΟΜΕΝΩΝ ΑΣΦΑΛΕΙΑΣ ΣΕ ΣΥΓΚΡΙΣΗ ΜΕ ΤΙΣ ΚΑΝΟΝΙΚΕΣ ΔΟΚΙΜΕΣ ΦΑΣΗΣ 3

Όχι μόνο αυτό, αν και έχουμε τεράστιο όγκο δεδομένων. Δοκιμές με δεκάδες χιλιάδες εμβολιασμούς. Επίσης, ασυνήθιστα, έχουμε πολλούς υποψήφιους για εμβόλια όλοι για την ίδια ασθένεια και με μικρές μόνο διαφορές.

Υπάρχουν σχεδόν 50 εμβόλια σε κλινική δοκιμή και 11 στη φάση 3, ένα από τα οποία έχει ήδη ολοκληρώσει το κύριο τελικό σημείο για τη φάση 3 από τη συγγραφή του παρόντος,

Από τους 11 στη φάση 3, οι 7 παρουσιάζουν συγκεκριμένα την αιχμή στο σώμα μας με διάφορους τρόπους και τέσσερις είναι αδρανοποιημένοι ιοί

Τα εμβόλια στη φάση 3 που παρουσιάζουν την ακίδα ως mRNA είναι:

Στη συνέχεια, η Novavax παρουσιάζει την ακίδα ως νανοσωματίδιο και στη συνέχεια αυτά που την συνδέουν με έναν αδενοϊό είναι

Στη συνέχεια, υπάρχουν τρεις αδρανοποιημένοι ιοί από την Κίνα και ένας από την Ινδία.

Αυτό είναι πολλά υποσχόμενο. Για λεπτομέρειες δείτε το δικό μου

Σε αυτό το βίντεο εξηγώ ότι η ακίδα από μόνη της είναι απλώς μια πρωτεΐνη και δεν έχει RNA σε αυτήν, επομένως μπορεί να αντιγραφεί. Αυτή είναι η εικόνα της ακίδας:

Επίσης, εξηγώ στο βίντεο ότι το mRNA μπορεί να & αντιγραφεί. Το RNA αγγελιοφόρου παράγεται από το DNA, αλλά μπορεί να αντιγραφεί από μόνο του σε ένα φυσιολογικό κύτταρο θηλαστικών. Τα κύτταρα μπορούν να αντιγράψουν το DNA αλλά όχι το RNA.

Έτσι οι ιοί RNA πρέπει να δημιουργήσουν τη δική τους μηχανή αντιγραφής. Αυτό το διάγραμμα εξηγεί σε γενικές γραμμές πώς ο ιός SARS-CoV2 παρασύρει το κύτταρο για να αναπαραχθεί.

Δεν έχω ιδέα τι σημαίνουν όλα ή θέλω απλώς να έχετε μια ιδέα για το πόσο πολύπλοκο είναι. Εάν είστε βιολόγος και θέλετε να δείτε τις λεπτομέρειες, μπορείτε να δείτε εδώ.


Δεν υπάρχουν ακόμη στοιχεία για ενίσχυση εξαρτώμενη από αντισώματα στον COVID-19

Ο δάγκειος πυρετός παραμένει το καλύτερα μελετημένο και ένα από τα ελάχιστα στερεά παραδείγματα της ADE. Πιστεύεται ότι εμφανίζεται σε κοινότητες όπου κυκλοφορούν πολλαπλά ιικά στελέχη του δάγκειου πυρετού. Ενώ τα αντισώματα έναντι ενός στελέχους δάγγειου πυρετού συνήθως προστατεύουν αξιόπιστα από αυτό το στέλεχος, τα πράγματα μπορεί να πάνε στραβά όταν τα αντισώματα συναντήσουν ένα διαφορετικό στέλεχος του δάγκειου πυρετού. Αντί να εξουδετερωθεί ο ιός - δηλαδή να συνδεθεί και να μπλοκάρει μια πρωτεΐνη που χρειάζεται ο παθογόνος οργανισμός για να εισέλθει στα κύτταρα ξενιστές - τα αντισώματα συνδέονται μόνο με τον ιό χωρίς να τον εξουδετερώσουν.

Αυτό μπορεί να γίνει πρόβλημα όταν τα κύτταρα του ανοσοποιητικού συστήματος, όπως τα μακροφάγα, προσκολλώνται στα άκρα της ουράς των αντισωμάτων χρησιμοποιώντας εξειδικευμένους υποδοχείς γνωστούς ως υποδοχείς Fc - κάτι που συχνά κάνουν για να καθαρίσουν τα υπολείμματα αντισωμάτων-ιών. Επειδή οι δάγκειοι ιοί μπορούν να χρησιμοποιήσουν υποδοχείς Fc για να μολύνουν τα κύτταρα, εάν τα αντισώματα δεν απενεργοποιούν τον παθογόνο παράγοντα, τελικά βοηθούν τον ιό να εισέλθει σε μακροφάγα για να μολύνει τα κύτταρα. Ινστιτούτο στην Καλιφόρνια. Αυτό ενισχύει τον πολλαπλασιασμό του ιού, πιέζοντας το ανοσοποιητικό σύστημα σε υπερβολική κίνηση και ανοίγοντας το δρόμο για σοβαρές ασθένειες. «Αυτό είναι το χαρακτηριστικό της ADE, βασικά. Το Το κάνετε τη μόλυνση ευκολότερη, μολύνετε περισσότερα κύτταρα, παίρνετε χειρότερη ασθένεια ».

Υπάρχουν όμως ακόμα πολλά ερωτήματα γύρω από την ADE και τον μηχανισμό της. Δεν είναι απολύτως σαφές, για παράδειγμα, εάν τα αντισώματα είναι οι μόνοι παράγοντες της ADE ή εάν άλλα μέρη του ανοσοποιητικού συστήματος παίζουν επίσης ρόλο. Ούτε είναι βέβαιο αν είναι αυστηρά το μη εξουδετερωτικό χαρακτηριστικό των αντισωμάτων που έχει μεγαλύτερη σημασία - θα μπορούσε επίσης να είναι ότι τα εξουδετερωτικά αντισώματα θα μπορούσαν επίσης να επιτρέψουν στους ιούς να μολύνουν μακροφάγα εάν δεν είναι αρκετά πολλοί για να μπλοκάρουν όλες τις βασικές πρωτεΐνες στην επιφάνεια ενός ιού.

«Μπορεί οποιοδήποτε αντίσωμα να ενισχυθεί εάν το παίρνετε σε δόση που δεν λειτουργεί», σημειώνει ο Τζέιμς Κρόου, ανοσολόγος στο Ιατρικό Κέντρο του Πανεπιστημίου Vanderbilt. «Αυτό είναι πολύ δύσκολο να μελετηθεί στους ανθρώπους».

Στερεά στοιχεία για ADE σε φυσικές ιογενείς λοιμώξεις υπάρχουν μόνο στον ιό του δάγκειου πυρετού και σε ορισμένους συγγενείς του. Υπάρχουν αρκετοί άλλοι ιοί όπου η ADE έχει αποδειχθεί in vitro - σε πειράματα που αναμειγνύουν μακροφάγα ή παρόμοια κύτταρα με αντισώματα και ιούς και βλέπουν εάν ο ιός είναι ικανός να μολύνει τα κύτταρα παρά την παρουσία αντισωμάτων, εξηγεί ο Crowe. Τέτοια πειράματα έχουν βρει υπαινιγμούς ADE με ιούς συμπεριλαμβανομένου του ιού Έμπολα, του HIV και κοροναϊών όπως το SARS και το MERS. Ωστόσο, παραμένει μυστήριο σε ποιο βαθμό αυτό συμβαίνει σε ζωντανούς οργανισμούς παρουσία ενός λειτουργικού ανοσοποιητικού συστήματος. «Το ανοσοποιητικό σύστημα συνήθως διαμορφώνει τα πράγματα προς όφελός σας. Δεν λέω ότι η ADE δεν εμφανίζεται στο σώμα - απλώς λέω ότι είναι δύσκολο να γεφυρωθούν τα αποτελέσματα στον δοκιμαστικό σωλήνα με αυτά που συμβαίνουν στο σώμα », λέει ο Crowe.

Δεν είναι ακόμη σαφές εάν ο SARS-CoV-2 είναι ικανός να μολύνει μακροφάγα. Αν και ορισμένοι επιστήμονες έχουν αναφερθεί ότι έχουν εντοπίσει ιική πρωτεΐνη μέσα σε μακροφάγα, αν όντως μολύνει και αναπαράγεται σε μακροφάγα στο σώμα «είναι κάτι που οι ερευνητές προσπαθούν να προσδιορίσουν αυτή τη στιγμή», λέει ο Crowe.

Ο Μπάρνεϊ Γκράχαμ, αναπληρωτής διευθυντής του Εθνικού Ινστιτούτου Ερευνών Εμβολίων και Λοιμωδών Νοσημάτων, το οποίο συνεργάζεται με την εταιρεία Moderna για εμβόλιο κατά του κορονοϊού, δήλωσε. PNAS Τον περασμένο μήνα αμφιβάλλει ότι ο μηχανισμός του δάγκειου πυρετού του ADE θα ίσχυε για τον SARS-CoV-2, επειδή ο κορωνοϊός στοχεύει κυρίως τους υποδοχείς ACE2, όχι Fc, και έχει πολύ διαφορετική παθογένεση σε σύγκριση με την οικογένεια του δάγκειου πυρετού. Και ακόμη και για τον αρχικό SARS που προκάλεσε έξαρση το 2003, πειράματα in vitro υποδηλώνουν ότι θα μπορούσε να μολύνει μια ανθρώπινη κυτταρική σειρά χρησιμοποιώντας έναν υποδοχέα Fc, αλλά ο ιός δεν αναπαράχθηκε σε μολυσματικά σωματίδια, γράφει ο Graham σε ένα προοπτικό άρθρο στο Επιστήμη.

Είναι θεωρητικά πιθανό ότι οι λοιμώξεις που προκαλούνται από άλλους κορωνοϊούς θα μπορούσαν να δημιουργήσουν αντισώματα στο αίμα των ανθρώπων και να προκαλέσουν ADE κατά τη μόλυνση με τον SARS-CoV-2, αλλά υπάρχουν λίγα στοιχεία για αυτό μέχρι στιγμής, σημειώνει ο Crowe. Και κατ' αρχήν, ορισμένοι ασθενείς με COVID-19 θα μπορούσαν να αναπτύξουν αντισώματα που δεν εξουδετερώνουν ή παράγουν εξουδετερωτικά σε ανεπαρκείς συγκεντρώσεις και στη συνέχεια να αναπτύξουν σοβαρά συμπτώματα μόλις μολυνθούν για δεύτερη φορά. Όμως, μια χούφτα αναφερόμενων εκ νέου λοιμώξεων του SARS-CoV-2 βρέθηκε ότι οφείλονται σε λανθασμένες εξετάσεις. Και δύο εκτυπώσεις εμφανίστηκαν την περασμένη εβδομάδα που υποδηλώνουν ότι σε ασθενείς στις ΗΠΑ που έλαβαν μεταγγίσεις πλάσματος αίματος που περιείχαν αντισώματα από επιζώντες του COVID-19, η θεραπεία δεν επιδείνωσε τη νόσο, υποστηρίζοντας το επιχείρημα κατά της ADE.


Υλικά και μέθοδοι

Κυτταρική καλλιέργεια και αντιδραστήρια

Όλες οι μελέτες πραγματοποιήθηκαν σύμφωνα με εγκεκριμένα πρωτόκολλα IRB από το Πανεπιστήμιο της Καλιφόρνια (UCSD), Σαν Ντιέγκο. Η κυτταρική σειρά ανθρώπινου επιθηλίου πνεύμονα Calu-3, η κυτταρική σειρά επιθηλίου ανθρώπινου κόλου Caco-2 ελήφθησαν από την ATCC. Το Calu-3 διατηρήθηκε σε μέσο ΜΕΜ συμπληρωμένο με 1 × ΝΕΑΑ, πενικιλίνη-στρεπτομυκίνη (100 IU/ml) και 10% FBS. Το Caco-2 καλλιεργήθηκε σε μέσο ΜΕΜ με 1 χ NEAA, πενικιλλίνη-στρεπτομυκίνη (100 IU/ml) και 20% FBS. Τα κύτταρα 293FT και Vero E6 διατηρήθηκαν σε μέσο DMEM με 10% FBS. Το αντίσωμα Spike που αναγνωρίζει S2 υπομονάδα SARS-CoV και SARS-CoV-2 αγοράστηκε από την Nouvs (NB100-56578). Το αντίσωμα Anti-VSV Μ προήλθε από το EMD Millipore (MABF2347). Τα πεπτίδια ΕΚ1 ελήφθησαν από την Phoenix Pharma. Το κιτ ανάλυσης Luciferase αγοράστηκε από την Promega. 7α-HC, 25HC, υδατοδιαλυτή χοληστερόλη και Sandoz 58-035 ελήφθησαν από τη Sigma. Τα Camostat, nafamostat και E-64d αγοράστηκαν από τη Selleck Chemicals.

VSV ψευδοϊός διάσωση, ενίσχυση και τιτλοδότηση

Ο ψευδοτυπικός VSV δημιουργήθηκε με βάση την εργασία που περιγράφηκε προηγουμένως (Whitt, 2010). Εν συντομία, τα κύτταρα BHK-21/WI-2 μολύνθηκαν με πολυμεράση Τ7 που εκφράζει vTF7-3 για 45 λεπτά και στη συνέχεια επιμολύνθηκαν με pVSV-EGFP-dG (πρόσθετο 31842) ή pVSV-FLuc-dG, μαζί με φορείς pBS που εκφράζουν VSV- N, VSV-P, VSV-L και VSV-G (Kerafast) σε αναλογία 3:3:5:1:8, χρησιμοποιώντας Opti-MEM και Lipofectamine 3000 σύμφωνα με τις οδηγίες του κατασκευαστή. 48 ώρες μετά τη διαμόλυνση, τα υπερκείμενα καλλιέργειας συλλέχθηκαν και διηθήθηκαν μέσω φίλτρων 0,22 μm για την απομάκρυνση του υπολειμματικού ιού δαμαλίτιδας. Κύτταρα 293FT επιμολυσμένα με pMD2.G (προσθήκη 12259) που κωδικοποιεί VSV-G για 24 ώρες εμβολιάστηκαν με το διήθημα για να ενισχύσουν τον ψευδοϊό VSV. 24 ώρες μετά τον εμβολιασμό, τα υπερκείμενα συλλέχθηκαν και είτε αποθηκεύτηκαν στους -80 ° C. Η τιτλοδότηση του ψευδοϊού που εκφράζει EGFP πραγματοποιήθηκε με ενοφθαλμισμό κυττάρων Vero Ε6 που είχαν σπαρθεί σε πλάκες 96 φρεατίων με 10πλάσιες σειριακές αραιώσεις του αποθέματος ιού. 24 ώρες μετά τον εμβολιασμό, μετρήθηκαν οι αριθμοί των GFP-θετικών κυττάρων και χρησιμοποιήθηκαν για τον υπολογισμό του τίτλου του ιού ως μολυσματική μονάδα ανά χιλιοστόλιτρο (IU/ml). Η τιτλοδότηση ψευδοϊών που εκφράζουν FLuc πραγματοποιήθηκε με ενοφθαλμισμό Vero Ε6 κυττάρων επιμολυσμένων με VSV-G σε πλάκες 24 φρεατίων με 10 φορές σειριακές αραιώσεις του αποθέματος ιού. Χρησιμοποιήθηκε 1 ώρα μετά τον εμβολιασμό, νέο μέσο που περιείχε 1,5% μεθυλοκυτταρίνη για να αντικαταστήσει το εμβόλιο. 2 ημέρες μετά τον εμβολιασμό, τα κύτταρα πλύθηκαν και χρωματίστηκαν με κρυσταλλική ιώδη. Οι αριθμοί των πλακών μετρήθηκαν και χρησιμοποιήθηκαν για τον υπολογισμό του τίτλου του ιού.

Παραγωγή, τιτλοδότηση και χαρακτηρισμός ψευδοϊών SARS-CoV-2, SARS-CoV και MERS-CoV

293FT κύτταρα επιμολύνθηκαν με pLVX που εκφράζει SARS-CoV-2-S, SARS-CoV-S ή MERS-CoV-S. Δεκαεννέα αμινοξέα στο C άκρο του SARS-CoV-2-S και του SARS-CoV-S διαγράφηκαν, δεδομένης της προηγούμενης αναφοράς ότι το συντομευμένο μετάλλαγμα έχει βελτιωμένη ενσωμάτωση στο φάκελο του ψευδοϊού (Fukushi et αϊ, 2005 Hoffmann et αϊ, 2020α). Σε 24 ώρες μετά τη μεταμόλυνση, τα κύτταρα μολύνθηκαν με ψευδοϊό VSV που περιείχε Fluc ή EGFP. Τα κύτταρα πλύθηκαν τέσσερις φορές με μέσο 1 ώρα μετά τον εμβολιασμό και διατηρήθηκαν σε μέσο για 24 ώρες. Στη συνέχεια, το υπερκείμενο που περιέχει ψευδοϊό συλλέχθηκε, φυγοκεντρήθηκε και χρησιμοποιήθηκε ή αποθηκεύτηκε στους -80 ° C. Ο τίτλος μετρήθηκε χρησιμοποιώντας την ίδια μέθοδο για τον ψευδοϊό VSV που αναφέρθηκε παραπάνω. Για τον χαρακτηρισμό του ψευδοϊού, το υπερκείμενο 1 ml συμπυκνώθηκε με υπερ-φυγοκέντρηση στα 106.750 σολ για 2 ώρες στους 4 ° C. Στη συνέχεια, προστέθηκαν 40 μl ρυθμιστικού διαλύματος λύσης με SDS και θερμάνθηκαν για 5 λεπτά στους 95 ° C. Τα δείγματα υποβλήθηκαν σε SDS -PAGE και ανοσοκηλίδωση χρησιμοποιώντας αντίσωμα ακίδας και αντίσωμα μήτρας VSV.

Θεραπεία ψευδοϊού SARS-CoV-2, SARS-CoV και MERS-CoV και θεραπεία αναστολέων

Τα κύτταρα υποβλήθηκαν σε προεπεξεργασία με 25HC για 16 ώρες και στη συνέχεια μολύνθηκαν με ψευδοϊό SARS-CoV-2, SARS-CoV και MERS-CoV σε φρέσκο ​​μέσο χωρίς 25HC. Μετά από μόλυνση 2 ωρών, ο ιός απομακρύνθηκε και προστέθηκε φρέσκο ​​μέσο χωρίς 25HC. Για ψευδοϊό με Fluc, τα κύτταρα λύθηκαν σε 24 ώρες μετά τη μόλυνση και υποβλήθηκαν σε δοκιμασία δραστικότητας λουσιφεράσης σύμφωνα με τις οδηγίες του κατασκευαστή. Για ψευδοϊό με EGFP, η μόλυνση αξιολογήθηκε με λήψη φωτογραφίας για τουλάχιστον 5 τυχαία πεδία 24 ώρες μετά τη μόλυνση.

Δοκιμή σύντηξης κυττάρων -κυττάρων

Τα κύτταρα 293FT ή Vero E6 υποβλήθηκαν σε επεξεργασία με EtOH ή 25HC όλη τη νύχτα και στη συνέχεια συν-επιμολύνθηκαν με pEGFP-C1 και ένα φορέα pLVX που εκφράζει ένα από τα SARS-CoV-2-S, SARS-CoV-S και MERS-CoV-S χρησιμοποιώντας Λιποφεκταμίνη 3000, απουσία EtOH ή 25HC. Συμπληρώθηκε 4 ώρες μετά τη μεταμόλυνση, φρέσκο ​​μέσο που περιείχε EtOH και 5 μΜ 25HC. Για κύτταρα 293FT, 24 ώρες μετά τη διαμόλυνση, τα κύτταρα χρωματίστηκαν με Hoechst για 10 λεπτά στους 37°C και εξετάστηκαν με μικροσκόπιο φθορισμού Leica (DMI 3000). Για το κύτταρο Vero E6, 48 ώρες μετά τη μεταμόλυνση, τα κύτταρα πλύθηκαν δύο φορές με PBS και επωάστηκαν με 2 μg/ml Τρυψίνη σε PBS για 20 λεπτά. Το PBS που περιέχει τρυψίνη απομακρύνθηκε στη συνέχεια και τα κύτταρα επωάστηκαν περαιτέρω σε μέσο για 40 λεπτά, πριν από μια χρώση 10 λεπτών Hoechst στους 37 ° C και εξέταση υπό μικροσκόπιο φθορισμού. Για ποσοτικοποίηση της σύντηξης μεμβράνης, το ποσοστό των πυρήνων που εμπλέκονται στο σχηματισμό συγκυτίων σε κάθε ομάδα υπολογίστηκε με μέσο όρο τρία αντίστοιχα πεδία και η έκταση της σύντηξης μεμβράνης για κάθε ομάδα υπολογίστηκε με μέσο όρο 3 ανεξάρτητες βιολογικές αντιγραφές για αυτήν την ομάδα.

Δοκιμασία σύνδεσης ψευδοϊού

Τα κύτταρα Calu-3 υποβλήθηκαν σε επεξεργασία με EtOH ή έδειξαν συγκεντρώσεις 25HC για 16 ώρες, πριν από την επώαση με ψευδοϊό SARS-CoV-2 σε ΜΟΙ = 2 στους 4 ° C. Τα κύτταρα στη συνέχεια πλύθηκαν με ψυχρό PBS τρεις φορές και λύθηκαν με ΤΡΙζόλη. Το RNA εκχυλίστηκε χρησιμοποιώντας κιτ RNA Direct-zol (Zymo). Η ποσότητα των δεσμευμένων ιοσωμάτων μετρήθηκε με RT-qPCR χρησιμοποιώντας εκκινητές για VSV-L. Τα αστάρια έχουν ως εξής: GAPDH (Εμπρός: GGCCTCCAAGGAGTAAGACC Αντίστροφη: AGGGGTCTACATGGCAACTG), VSV-μεγάλο (Εμπρός: GACGGGCTCATCAGTCTATTT Αντίστροφη: GGATACCTCACTCTCCTCACAATC).

Καθαρισμός, επισήμανση και επώαση πρωτεΐνης ALOD4

Η πρωτεΐνη ALOD4 εκφράστηκε, καθαρίστηκε και επισημάνθηκε με βάση ένα προηγουμένως περιγραφόμενο πρωτόκολλο (Endapally et αϊ, 2019). Εν συντομία, το πλασμίδιο pALOD4 (Addgene 111026) μετασχηματίστηκε σε BL21(DE3)pLysS ικανά κύτταρα (Invitrogen) (Gay et αϊ, 2015). ALOD4-Του6 καθαρίστηκε χρησιμοποιώντας το κιτ καθαρισμού Capturem His-tagged (Takara). Η καθαρισμένη πρωτεΐνη συμπυκνώθηκε περαιτέρω με φυγόκεντρα φίλτρα Amicon Ultra 10 kD.Για την επισήμανση ALOD4 από την Alexa Fluor 488 C5 (AF488) (Invitrogen), το ALOD4 αναμίχθηκε με AF488 στους 4°C για 16 ώρες. Η αντίδραση σβήστηκε με 10 mM DTT. Η περίσσεια της βαφής απομακρύνθηκε με αφαλάτωση.

Για τον προσδιορισμό δέσμευσης ALOD4, 3 μΜ καθαρισμένου ή επισημασμένου ALOD4 προστέθηκαν σε κάθε φρεάτιο και τα κύτταρα που υπέστησαν αγωγή με αιθανόλη ή 25HC επωάστηκαν με ALOD4 για 30 λεπτά στους 37 ° C. Τα κύτταρα πλύθηκαν δύο φορές με PBS πριν από την παρασκευή δείγματος WB. Για τον προσδιορισμό δέσμευσης ALOD4 με διάσωση χοληστερόλης, τα κύτταρα που υπέστησαν επεξεργασία με αιθανόλη και 25HC υποβλήθηκαν σε επεξεργασία με χοληστερόλη για 1 ώρα στους 37°C πριν από την επώαση με ALOD4. Για τον προσδιορισμό δέσμευσης ALOD4 με SZ58-035, το όχημα ή το SZ58-035 ήταν παρόν κατά τη διάρκεια της θεραπείας με 25HC και της επώασης με ALOD4.

Δοκιμές διάσωσης χοληστερόλης και Sandoz 58-035

Τα κύτταρα Calu-3 υποβλήθηκαν σε προεπεξεργασία με Αιθανόλη ή 5 μΜ 25HC για 16 ώρες. Για το πείραμα διάσωσης της χοληστερόλης, τα κύτταρα πλύθηκαν και επωάστηκαν με PBS ή 80 μΜ υδατοδιαλυτή χοληστερόλη για 1 ώρα. Προστέθηκε φρέσκο ​​μέσο και ψευδοϊός SARS-CoV-2 χωρίς ενώσεις για επώαση με τα κύτταρα για 2 ώρες. Στη συνέχεια, τα κύτταρα πλύθηκαν και καλλιεργήθηκαν σε φρέσκο ​​μέσο. Για το πείραμα διάσωσης Sandoz 58-035, μετά από ολονύκτια θεραπεία 25HC παρουσία DMSO ή 40 μM SZ58-035, τα κύτταρα Calu-3 πλύθηκαν και επωάστηκαν με DMSO ή 40 μM SZ58-035 για 1 ώρα πριν από τη μόλυνση με SARS- Ψευδοϊός CoV-2. Για ψευδοϊό με Fluc, τα κύτταρα υποβλήθηκαν σε λύση και υποβλήθηκαν σε μέτρηση δραστικότητας λουσιφεράσης στις 24 ώρες μετά τη μόλυνση. Για τον ψευδοϊό EGFP, τα σήματα EGFP καταγράφηκαν με μικροσκόπιο φθορισμού σε 24 ώρες μετά τη μόλυνση.

Δοκιμές διάσωσης ACAT knockdown

Τα κύτταρα Calu-3 μεταφέρθηκαν με λεντιϊό που εκφράζει shACAT1/2 για 48 ώρες. Στη συνέχεια, τα κύτταρα υποβλήθηκαν σε επεξεργασία με μέσο που περιείχε EtOH ή 5 μΜ 25HC όλη τη νύχτα. Τα κύτταρα Calu-3 πλύθηκαν πριν από τη μόλυνση με ψευδοϊό SARS-CoV-2. Τα κύτταρα λύθηκαν και υποβλήθηκαν σε μέτρηση δραστικότητας λουσιφεράσης 24 ώρες μετά τη μόλυνση.

Λοίμωξη απομόνωσης SARS-CoV-2 USA-WA1/2020

Το απομονωμένο SARS-CoV-2 USA-WA1/2020 ελήφθη από τους πόρους BEI. Ο SARS-CoV-2 πολλαπλασιάστηκε και οι μολυσματικές μονάδες ποσοτικοποιήθηκαν με ανάλυση πλάκας χρησιμοποιώντας κύτταρα Vero E6. Τα κύτταρα Calu-3 υποβλήθηκαν σε προεπεξεργασία με 25HC όλη τη νύχτα και στη συνέχεια μολύνθηκαν με SARS-CoV-2 σε ΜΟΙ = 0,1 για 1 ώρα στους 37 ° C. Στη συνέχεια, τα κύτταρα πλύθηκαν και συμπληρώθηκε φρέσκο ​​μέσο με 25HC. 48 ώρες μετά τη μόλυνση, το υπερκείμενο και τα μολυσμένα κύτταρα λύθηκαν χρησιμοποιώντας TRIzol και το RNA εκχυλίστηκε χρησιμοποιώντας κιτ RNA Direct-zol (Zymo) και ποσοτικοποιήθηκε με RT-qPCR χρησιμοποιώντας εκκινητές SARS-CoV-2 N. Τα αστάρια έχουν ως εξής: SARS-CoV-2-N (Εμπρός: CACATTGGCACCCGCAATC Πίσω: GAGGAACGAGAAGAGGCTTG). Ο τίτλος του ιού στο υπερκείμενο ποσοτικοποιήθηκε με ανάλυση πλάκας σε κύτταρα Vero.

Χρώση σταγονιδίων λιπιδίων

Τα κύτταρα Calu-3 εναιωρήθηκαν σε μέσο ΜΕΜ με 2% ορό εξαντλημένο με λιπίδια και φυτεύτηκαν στα φρεάτια ενός θαλάμου 4-φρεατίων Lab-TEK II ή μιας πλάκας 96 φρεατίων. Για τη θεραπεία με 25HC, τα κύτταρα υποβλήθηκαν σε επεξεργασία με 5 μM 25HC για 16 ώρες. Στη συνέχεια, τα κύτταρα πλύθηκαν και χρωματίστηκαν με 1 × LipidSpot 488 (Biotium) για 30 λεπτά. Τα σήματα καταγράφηκαν με μικροσκόπιο φθορισμού. Για τη μόλυνση με ζωντανό ιό SARS-CoV-2, τα κύτταρα Calu-3 μολύνθηκαν με SARS-CoV-2 USA-WA1/2020 σε ΜΟΙ = 2 για 1 ώρα στους 37 ° C. Στη συνέχεια, τα κύτταρα πλύθηκαν και συμπληρώθηκε φρέσκο ​​μέσο. Τα κύτταρα χρωματίστηκαν με 1 × LipidSpot 488 για 30 λεπτά μετά από 24 ώρες μετά τη μόλυνση. Το σήμα φθορισμού καταγράφηκε από το Incucyte S3.

Θεραπεία και λοίμωξη πνευμονικού οργανοειδούς 25HC

Τα ανθρώπινα οργανοειδή πνεύμονα που προέρχονται από το iPSC δημιουργήθηκαν χρησιμοποιώντας μεθόδους που είχαν δημοσιευθεί προηγουμένως (Leibel et αϊ, 2019 Μίλερ et αϊ, 2019 ) και χαρακτηρίζεται από έκφραση ACE2, TMPRSS2 και επιθηλιακών δεικτών κυψελιδικών κυττάρων (SFTPC, SFTPB, HOPX) (Tiwari et αϊ, Χειρόγραφο υπό προετοιμασία). Αυτά τα διαφοροποιημένα 60D πνευμονικά οργανοειδή υποβλήθηκαν σε προεπεξεργασία όλη τη νύχτα με 25HC (5 μM) και μολύνθηκαν με ψευδοϊό SARS-CoV-2 που εκφράζει τη λουσιφεράση (100 μl). Στις 2 ώρες μετά τη μόλυνση, τα οργανοειδή επωάστηκαν με φρέσκο ​​μέσο που περιείχε 25HC. Μετά από 24 ώρες, η δραστηριότητα της λουσιφεράσης μετρήθηκε για να ποσοτικοποιηθεί η ιογενής μόλυνση.

Παραγωγή και μεταγωγή φακοϊού

Δύο ολιγοί sgRNA που στοχεύουν ACE2 κλωνοποιήθηκαν σε lentiCRISPR v2 (addgene 52961) και δύο shRNA oligos που στοχεύουν ACAT1 και ACAT2 κλωνοποιήθηκαν σε pLKO.1 (πρόσθετο 8453). CH25H κλωνοποιήθηκε σε φορείς pLVX. Οι αλληλουχίες στόχοι του sgRNA και του shRNA είναι οι εξής: ACE2-sgRNA1: CAGGATCCTTATGTGCACAA ACE2-sgRNA2: CCAAGGCGAGAGATAGTTG ACAT1-shRNA: GCCACTAAGCTTGGTTCCATT ACAT2-shRNA: GCTCTTATGAAGAAGTCAGAA. Τα αστάρια κλωνοποίησης για CH25H (Εμπρός: GGATCTATTTCCGGTGAATTCATGAGCTGCCACAACTGCTCC Αντίστροφη: GCGGTCATACGTAGGATCCTTACCGCGCTGGGACAGATG). Κύτταρα 293FT που σπάρθηκαν σε πλάκες 6 φρεατίων συν-επιμολύνθηκαν με pMD2.G (0,6 μg), psPAX.2 (1,2 μg) και φορέα sgRNA, pLVX ή pLKO.1 (1,8 μg) χρησιμοποιώντας Opti-MEM και Lipofectamine 3000 σύμφωνα με τις οδηγίες του κατασκευαστή. Στις 4 ώρες μετά την επιμόλυνση, το υπερκείμενο αντικαταστάθηκε με φρέσκο ​​μέσο. Στις 48 ώρες μετά τη διαμόλυνση, το υπερκείμενο συλλέχτηκε και χρησιμοποιήθηκε για τη μεταγωγή κυττάρων Calu-3. Μετά από 12 ώρες μεταγωγής, ο φακοϊός αφαιρέθηκε και αντικαταστάθηκε με φρέσκο ​​μέσο.

Δοκιμή βιωσιμότητας κυττάρων

Τα κύτταρα Calu-3 ή Caco-2 υποβλήθηκαν σε επεξεργασία με EtOH ή διπλές σειριακές αραιώσεις 25HC για 48 ώρες. Τα κύτταρα εξετάστηκαν στη συνέχεια για επίπεδα ΑΤΡ χρησιμοποιώντας CellTiter-Glo (Promega) σύμφωνα με τις οδηγίες του κατασκευαστή.

Western blot και αντισώματα

Τα κυτταρολύματα υποβλήθηκαν σε SDS-PAGE σε πηκτές Bis-Tris 4–20% και μεταφέρθηκαν σε μεμβράνες PVDF. Το Pierce Fast Western Blot Kit (Thermo Scientific) χρησιμοποιήθηκε για την εκτέλεση ανοσοκηλίδων σύμφωνα με τις οδηγίες του κατασκευαστή με τα ακόλουθα αντισώματα: ποντίκι με σήμανση αντι-His (Millipore 05-949) και αντι-τουμπουλίνη ποντικού συζευγμένο με HRP (Proteintech HRP-66031) . Πραγματοποιήθηκε χημειοφωταύγεια αντισώματος σημασμένου με αντι-His με Υπόστρωμα Μέγιστης Ευαισθησίας SuperSignal West Femto (Thermo Scientific).

Ανάλυση RNA-seq από κύτταρα μολυσμένα με SARS-CoV-2 και ασθενείς μολυσμένους με COVID-19

Για τα δεδομένα RNA-seq από SARS-CoV-2, IAV, HPIV3 και RSV λοίμωξη (Blanco-Melo et αϊ, 2020), υπολογίστηκε η γονιδιακή έκφραση στόχος σε μολυσμένα κύτταρα σε σχέση με τους μη μολυσμένους μάρτυρες και το log2 (αλλαγή πτυχών) εμφανίστηκε ως θερμός χάρτης. Για ανάλυση αλληλουχίας RNA ενός κυττάρου από ασθενείς που έχουν μολυνθεί από COVID-19, το σύνολο δεδομένων scRNA-seq για βρογχοκυψελιδικό υγρό πλύσης από τέσσερις υγιείς μάρτυρες, τρεις ασθενείς με μέτρια μόλυνση από COVID-19 και έξι σοβαρούς ασθενείς με λοίμωξη από COVID-19 λήφθηκαν από το GEO με τον αριθμό πρόσβασης GSE145926 (Liao et αϊ, 2020). Η ανάλυση βασίστηκε στον πίνακα μέτρησης αναγνωσμένων, με πληροφορίες τύπου κελιού που παρέχονται από το αρχείο κειμένου μετα-σχολιασμού. Οι μετρήσεις αναγνώσεων κάθε γονιδίου συλλέχθηκαν και υπολογίστηκαν χρησιμοποιώντας το αρχείο μήτρας HDF5 που παρέχεται. Με βάση αυτήν την ανάλυση σχεδιάζεται το διάγραμμα του πλαισίου καταμέτρησης ανάγνωσης για ασθενείς με HD, μέτριους και σοβαρούς μολυσμένους με COVID-19.

Στατιστική ανάλυση

Όλα τα δεδομένα και τα γραφήματα αναλύθηκαν και σχεδιάστηκαν χρησιμοποιώντας το Prism 8.0.2 (GraphPad Inc.). Η στατιστική ανάλυση πραγματοποιήθηκε χρησιμοποιώντας Student's τ-Δοκιμή (ζευγάρικο, διπλής όψης) εάν δεν αναφέρεται ειδικά στους μύθους του σχήματος. Τα δεδομένα παρουσιάζονται ως μέσος όρος ± τυπική απόκλιση (SD).


Κίνδυνοι από το εμβόλιο COVID-19

https://commons.wikimedia.org/wiki/File:Sputnik_V_Vaccine_Representation.jpg

Του ROMEO F. QUIJANO, M.D.
Καθηγητής (Ret.)
Τμήμα Φαρμακολογίας και Τοξικολογίας
College of Medicine, University of the Philippines Manila

Το εμβόλιο COVID-19 (SARS-Cov-2) είναι γεμάτο κινδύνους. Αυτό θα πρέπει να είναι το προφανές, ορθολογικό συμπέρασμα για όποιον ενδιαφέρεται να μελετήσει αντικειμενικά τις διαθέσιμες επιστημονικές και άλλες σχετικές πληροφορίες σχετικά με αυτό. Υπάρχουν πολλά πραγματικά σήματα κινδύνου που είναι εύκολα διακριτά.

Κατά τη διάρκεια της επιδημίας SARS-1 2002-2003, χρειάστηκαν περίπου 20 μήνες για να ετοιμαστεί ένα εμβόλιο για δοκιμές σε ανθρώπους σε κλινικές δοκιμές παρά το γεγονός ότι οι ανησυχίες για την ασφάλεια δεν είχαν ακόμη επιλυθεί. Αυτό ήταν ήδη πολύ γρήγορο σε σύγκριση με τον συνηθισμένο χρόνο που απαιτείται για να ολοκληρωθούν ικανοποιητικά οι προκλινικές δοκιμές ή οι μελέτες σε ζώα πριν ξεκινήσουν οποιοσδήποτε ηθικός πειραματισμός σε ανθρώπους ή κλινικές δοκιμές. Ωστόσο, για τα υποψήφια εμβόλια Covid-19, οι κλινικές δοκιμές ξεκίνησαν μόλις πέντε μήνες μετά την εμφάνιση του SARS-Cov-2, παρακάμπτοντας τις απαραίτητες προκλινικές μελέτες που συνήθως απαιτούνται και αγνοώντας τις σοβαρές ανησυχίες για την ασφάλεια στην προηγούμενη προσπάθεια βιαστικής λήψης εμβολίου SARS-1 ( που τελικά διαλύθηκε).

Μια σημαντική ανησυχία για την ανάπτυξη ενός εμβολίου είναι πώς να αποφύγετε τον κίνδυνο ότι το εμβόλιο μπορεί πραγματικά να "ενισχύσει" την παθογένεια του ιού ή να γίνει πιο επιθετικό πιθανώς λόγω της ενίσχυσης που εξαρτάται από τα αντισώματα (ADE), όπως συνέβη με το προηγούμενο μελέτες για δοκιμαστικά εμβόλια σε ζώα. Εάν αυτό συμβεί σε μια μεγάλη ανθρώπινη δοκιμή, το αποτέλεσμα θα μπορούσε να είναι καταστροφικό. (1,2,3,4) Αυτή η σοβαρή ανεπιθύμητη ενέργεια μπορεί να μην ανιχνευθεί καν από μια κλινική δοκιμή, ειδικά σε κλινικές δοκιμές υψηλής προκατάληψης με σύγκρουση συμφερόντων που αφορούν εταιρείες εμβολίων. Ακόμη και όταν ανιχνεύεται ένα σοβαρό ανεπιθύμητο συμβάν, αυτό συνήθως σκουπίζεται κάτω από το χαλί.

Για παράδειγμα, τα αποτελέσματα των αρχικών κλινικών δοκιμών για το εμβόλιο COVID-19 της Moderna φέρεται να έδειξαν ότι τρία από τα 15 πειραματικά άτομα στην ομάδα υψηλής δόσης υπέφεραν σοβαρά και ιατρικά σημαντικά συμπτώματα. Η Moderna, ωστόσο, κατέληξε στο συμπέρασμα ότι το εμβόλιο ήταν «γενικά ασφαλές και καλά ανεκτό», το οποίο ανέφεραν ευσυνείδητα τα κυρίαρχα από τις εταιρείες μέσα ενημέρωσης, καλύπτοντας τον πραγματικό κίνδυνο από το εμβόλιο.(5,6,7,8) Σε μια θρασύδειλη πράξη ανήθικη συμπεριφορά, η Moderna χρησιμοποίησε ακόμη και έναν εθελοντή λήπτη εμβολίου, τον Ian Haydon, για να εμφανιστεί σε πολλές εμφανίσεις στα μέσα ενημέρωσης που προωθούν το πειραματικό εμβόλιο της Moderna για τον COVID-19. Η Moderna ενθάρρυνε τον Haydon να εμφανιστεί στην τηλεόραση για να εξαπατήσει το κοινό και τους μετόχους του. Λιγότερο από 12 ώρες μετά τον εμβολιασμό, ο Χέιντον υπέφερε μυϊκούς πόνους, έμετο, πυρετό 103,2 μοιρών και είχε χάσει τις αισθήσεις του. που χρηματοδοτήθηκε από τον Bill Gates, χρησιμοποίησε μια πειραματική τεχνολογία mRNA που υποτίθεται ότι θα επέτρεπε την ταχεία ανάπτυξη, παραιτώντας τις συνήθεις προκλινικές μελέτες και μελέτες σε ζώα.

Το γεγονός ότι μια εντελώς νέα τεχνολογία εμβολίου RNA που δεν έχει χρησιμοποιηθεί ποτέ πριν στους ανθρώπους είναι ένα σήμα κινδύνου που δεν πρέπει να αγνοηθεί. Αρκετοί από τους υποψήφιους Αμερικανούς (Moderna, Pfizer/BioNTech και Arcturus Therapeutics) χρησιμοποιούν αυτήν την ποτέ προηγουμένως εγκεκριμένη τεχνολογία. Το εξωγενές mRNA είναι εγγενώς ανοσοδιεγερτικό και αυτό το χαρακτηριστικό του mRNA μπορεί να είναι ευεργετικό ή επιζήμιο. Μπορεί να παρέχει επικουρική δραστηριότητα και μπορεί να αναστείλει την έκφραση αντιγόνου και να επηρεάσει αρνητικά την ανοσοαπόκριση. Οι παράδοξες επιδράσεις της έμφυτης ανοσολογικής ανίχνευσης σε διαφορετικές μορφές εμβολίων mRNA δεν είναι πλήρως κατανοητές. Οι πιθανές ανησυχίες για την ασφάλεια περιλαμβάνουν τοπική και συστηματική φλεγμονή, βιοκατανομή και επιμονή του εκφρασμένου ανοσογόνου, διέγερση αυτοαντιδραστικών αντισωμάτων και πιθανές τοξικές επιδράσεις των μη φυσικών νουκλεοτιδίων και των συστατικών του συστήματος χορήγησης. Ένα εμβόλιο που βασίζεται σε mRNA θα μπορούσε επίσης να προκαλέσει ισχυρές αποκρίσεις ιντερφερόνης τύπου Ι, οι οποίες έχουν συσχετιστεί όχι μόνο με φλεγμονή αλλά και δυνητικά με αυτοάνοση. Ένα άλλο πιθανό ζήτημα ασφάλειας θα μπορούσε να προέλθει από το εξωκυτταρικό RNA το οποίο έχει αποδειχθεί ότι αυξάνει τη διαπερατότητα των στενά συσκευασμένων ενδοθηλιακών κυττάρων και μπορεί να προάγει την πήξη του αίματος και τον σχηματισμό παθολογικού θρόμβου. (10)

Ένας άλλος κίνδυνος των εμβολίων mRNA είναι η χρήση βιοτεχνολογικών «συστημάτων φορέων» που περιλαμβάνουν νανοσωματίδια λιπιδίων (LNP). Τα LNP «περικλείουν τα mRNA κατασκευάσματα για να τα προστατεύσουν από την υποβάθμιση και να προωθήσουν την κυτταρική απορρόφηση», και επιπλέον, αναβαθμίζουν το ανοσοποιητικό σύστημα. Τα σκευάσματα LNP στα τρία εμβόλια mRNA Covid-19 είναι επίσης "PEGylated", πράγμα που σημαίνει ότι τα νανοσωματίδια του εμβολίου είναι
επικαλυμμένο με ένα συνθετικό, μη βιοδιασπώμενο και όλο και πιο αμφιλεγόμενο πολυμερές που ονομάζεται πολυαιθυλενογλυκόλη (PEG). Τα LNP θα μπορούσαν να συμβάλουν σε ένα ή περισσότερα από τα ακόλουθα: ανοσολογικές αντιδράσεις, αντιδράσεις έγχυσης, αντιδράσεις συμπληρώματος, αντιδράσεις οψωνισμού, αντιδράσεις αντισωμάτων ή αντιδράσεις στο PEG από ορισμένα λιπίδια ή PEG που συνδέονται διαφορετικά με το LNP, καθώς και ανεπιθύμητες αντιδράσεις εντός ηπατικών οδών ή αποικοδόμηση του mRNA ή του LNP, οποιοδήποτε από τα οποία θα μπορούσε να οδηγήσει σε σημαντικά ανεπιθύμητα συμβάντα. Επιπλέον, η PEG μπορεί επίσης να προκαλέσει σοβαρά νευροψυχιατρικά συμπτώματα σε απογόνους, όπως μεταβολές της διάθεσης, οργή, φοβίες και παράνοια. Οι ερευνητές που κάποτε υπέθεταν ότι το πολυμερές ήταν σε μεγάλο βαθμό «αδρανές» τώρα αμφισβητούν τη βιοσυμβατότητά του και προειδοποιούν για την προώθηση της ανάπτυξης όγκου από τα PEGylated σωματίδια και τις δυσμενείς ανοσολογικές αντιδράσεις που περιλαμβάνουν «πιθανώς υποδιαγνωσμένη» απειλητική για τη ζωή αναφυλαξία. Αυτό αποτελεί σημαντική ανησυχία αφού μια αμερικανική μελέτη του 2016 ανέφερε ανιχνεύσιμα και μερικές φορές υψηλά επίπεδα αντι-PEG αντισωμάτων (συμπεριλαμβανομένων αντισωμάτων IgM πρώτης γραμμής άμυνας και αντισωμάτων IgG μεταγενέστερου σταδίου) σε περίπου 72% των σύγχρονων ανθρώπινων δειγμάτων και περίπου 56 % των ιστορικών δειγμάτων από τη δεκαετία του 1970 έως τη δεκαετία του 1990. Οι κατασκευαστές εμβολίων γενετικά τροποποιημένων αδενοϊικών φορέων COVID-19 που υποβάλλονται σε κλινικές δοκιμές (Johnson & Johnson, Oxford και CanSino) χρησιμοποιούν επίσης το PEG ως φθηνό πρόσθετο για την αποθήκευση εμβολίων. Εάν ένα από τα PEGylated εμβόλια mRNA για Covid-19 λάβει έγκριση, η αυξημένη έκθεση σε PEG θα είναι άνευ προηγουμένου και δυνητικά καταστροφική. (11,12)

Όπως τα εμβόλια mRNA, τα εμβόλια για τον αδενοϊικό φορέα COVID-19 εξακολουθούν να είναι πειραματικά και δεν έχουν χρησιμοποιηθεί στο παρελθόν σε μαζικούς εμβολιασμούς για μολυσματικές ασθένειες. Δεδομένου του ιστορικού των κακών δεδομένων ασφαλείας για πολλά εμβόλια, ο κίνδυνος απρόβλεπτων και δυνητικά καταστροφικών δυσμενών επιπτώσεων είναι εξαιρετικά ανησυχητικός.

Για παράδειγμα, μεταξύ άλλων κινδύνων, τα εμβόλια που φέρουν τον ιό θα μπορούσαν να υποστούν ανασυνδυασμό με φυσικούς ιούς και να παράγουν υβριδικούς ιούς που θα μπορούσαν να έχουν ανεπιθύμητες ιδιότητες που επηρεάζουν τη μετάδοση ή τη μολυσματικότητα. Οι πολυάριθμες μεταβλητές που επηρεάζουν την πιθανότητα να πραγματοποιηθεί ο ανασυνδυασμός και τα πιθανά αποτελέσματα του ανασυνδυασμού είναι πρακτικά αδύνατο να ποσοτικοποιηθούν με ακρίβεια δεδομένων των υφιστάμενων εργαλείων και γνώσεων. Ωστόσο, οι κίνδυνοι είναι πραγματικοί, όπως παραδείγματα της εμφάνισης μεταλλαγμένων τύπων ιών, αυξημένη παθογένεια και απροσδόκητα σοβαρά ανεπιθύμητα συμβάντα (συμπεριλαμβανομένου του θανάτου) μετά από τυχαίες εκστρατείες μαζικού εμβολιασμού και προηγούμενες αποτυχημένες προσπάθειες ανάπτυξης χιμαιρικών εμβολίων χρησιμοποιώντας τεχνολογία γενετικής μηχανικής.

Τα γενετικά τροποποιημένα εμβόλια φέρουν σημαντική απρόβλεπτη και μια σειρά εγγενών επιβλαβών δυνητικών κινδύνων, συμπεριλαμβανομένων των ακούσιων και ανεπιθύμητων παρενεργειών σε σχέση με στοχευμένα ή μη στοχευμένα άτομα. Οι πιθανές ανεπιθύμητες ανοσολογικές επιδράσεις περιλαμβάνουν απροσδόκητη ανοσοπαθολογική αντίδραση, αυτοάνοση αντίδραση, μακροχρόνια ανοχή, επίμονη μόλυνση και λανθάνουσες λοιμώξεις. Υπάρχει επίσης η δυνατότητα μεταφοράς ή ανασυνδυασμού γενετικού υλικού από γενετικά τροποποιημένους ιούς ή εμβόλια φορέων ιού GE στα στοχευόμενα μεμονωμένα κύτταρα γεννητικής σειράς. Μπορεί επίσης να υποβληθεί σε χρωμοσωμική ολοκλήρωση ή εισαγωγή μεταλλαξογένεσης, οδηγώντας σε τυχαίες εισαγωγές κατασκευών εμβολίου σε κυτταρικά γονιδιώματα ξενιστών, με αποτέλεσμα μεταβολές της γονιδιακής έκφρασης ή ενεργοποίηση κυτταρικών ογκογονιδίων, αυξάνοντας έτσι την πιθανότητα πρόκλησης όγκων. Ακόμη και μικρές γενετικές αλλαγές ή διαφορές μεταξύ των ιών μπορεί να οδηγήσουν σε δραματικές αλλαγές στις ικανότητες μετάδοσης, τις προτιμήσεις του ξενιστή και τη λοιμογόνο δράση. Οι νέοι, υβριδικοί απόγονοι ιών που προκύπτουν από τέτοια γεγονότα μπορεί να έχουν εντελώς απρόβλεπτα χαρακτηριστικά. Η αναστροφή της μολυσματικότητας, για παράδειγμα, τεκμηριώθηκε όταν ένα εμβόλιο ζωντανής ανασυνδυασμένης γλυκοπρωτεΐνης δαμαλίτιδας-λύσσας που παρασκευάστηκε για άγρια ​​ρακούν και αλεπούδες μόλυναν μια έγκυο γυναίκα 28 ετών. (13) Η αναστροφή της μολυσματικότητας τεκμηριώθηκε επίσης όταν ο ανασυνδυασμός μεταξύ εμπορικών εμβολίων ιού λοιμώδους λαρυγγοτραχειίτιδας (ILTV) σε πουλερικά είχε ως αποτέλεσμα λοιμογόνους ανασυνδυασμένους ιούς που προκάλεσαν σοβαρή ασθένεια και που αναδείχθηκαν ως τα κυρίαρχα στελέχη αγρού σε σημαντικές περιοχές παραγωγής πουλερικών στην Αυστραλία. (14)

Οι κίνδυνοι του ανασυνδυασμού τέθηκαν στην πραγματικότητα νωρίτερα σε μια συνάντηση που συγκλήθηκε από τον Παγκόσμιο Οργανισμό Υγείας το 2003, όπου οι ρυθμιστικές αρχές που εκπροσωπούν την Ευρωπαϊκή Ένωση, τις ΗΠΑ, την Κίνα και τον Καναδά έθεσαν το συγκεκριμένο ζήτημα σχετικά με τον ανασυνδυασμό: “Ανασυνδυασμός ζωντανού ιού με φορέα εμβόλιο με έναν κυκλοφορούντα ή επανενεργοποιημένο λανθάνοντα ιό θα μπορούσε θεωρητικά να δημιουργήσει ένα πιο παθογόνο στέλεχος…Ο κίνδυνος ανασυνδυασμού θα πρέπει να μελετηθεί εάν είναι δυνατόν σε ένα σύστημα μη κλινικού μοντέλου, αλλά θα πρέπει επίσης να ληφθεί υπόψη σε σχέδια κλινικών μελετών.” τις «συστάσεις προς τον ΠΟΥ και τις προτεραιότητες για μελλοντική εργασία» ως ένα από τα πολλά «ζητήματα κρίσιμης σημασίας που πρέπει να διερευνηθούν περαιτέρω». (15) Προφανώς, ωστόσο, ο ΠΟΥ, οι κυβερνήσεις και η βιομηχανία εμβολίων δεν πήραν ποτέ σοβαρά αυτήν τη σύσταση. Αυτό δεν αποτελεί έκπληξη, δεδομένης της ιστορίας της ταχείας έγκρισης και έγκρισης από τον ΠΟΥ πολλών τέτοιων εμβολίων με ζωντανούς ιούς χωρίς τις απαραίτητες και ενδελεχείς μελέτες ασφάλειας, που αφορούν ιδιαίτερα τον τρέχοντα τρελό αγώνα για ένα εμβόλιο COVID-19.

Υπάρχει επίσης μια ανησυχία ότι μερικοί άνθρωποι μπορεί να έχουν ήδη ανοσία στον αδενοϊό που μεταφέρει το γονίδιο του κοροναϊού στο σώμα, καθώς οι αδενοϊοί κυκλοφορούν στον ανθρώπινο πληθυσμό καθιστώντας το εμβόλιο αναποτελεσματικό. (16) Τα δεδομένα σχετικά με την αρχική κλινική δοκιμή του αδενοϊικού φορέα εμβολίου COVID-19 που έγινε από την CanSino Biologics της Κίνας και δημοσιεύθηκαν στο Lancet έδειξαν ότι στην υψηλότερη από τις τρεις δόσεις που χρησιμοποιήθηκαν στη μελέτη, ο αριθμός των ανεπιθύμητων ενεργειών ήταν υψηλός — Το 75% των ατόμων στην ομάδα της υψηλότερης δόσης ανέφεραν τουλάχιστον μία ανεπιθύμητη ενέργεια. Οι ανεπιθύμητες ενέργειες περιελάμβαναν πυρετό — πόνο στο σημείο της ένεσης, πονοκέφαλο, κόπωση, μεταξύ άλλων. Δέκα εθελοντές (9%της συνολικής ομάδας μελέτης) είχαν παρενέργειες βαθμού 3, που ορίστηκαν ως «σοβαρά και ιατρικά σημαντικά συμπτώματα», έξι (17%) στην ομάδα υψηλότερων δόσεων και δύο (6%) ο καθένας στη χαμηλή και μεσαία δόση ομάδες. Η μελέτη διαπίστωσε επίσης ότι μία δόση του εμβολίου, που δοκιμάστηκε σε τρία διαφορετικά επίπεδα, φάνηκε να προκαλεί καλή ανοσολογική απόκριση σε ορισμένα άτομα. Αλλά περίπου οι μισοί εθελοντές - άτομα που είχαν ήδη ανοσία στη ραχοκοκαλιά του εμβολίου - είχαν εξασθενημένη ανοσολογική απάντηση. (17)

Το φιάσκο του εμβολίου Dengvaxia στις Φιλιππίνες δείχνει επίσης τον κίνδυνο να γίνει εσπευσμένα ένα εμβόλιο και να επιτραπεί στα εταιρικά συμφέροντα που κινούνται από τις δυνάμεις της αγοράς να αντιμετωπίσουν τις ανάγκες υγείας των ανθρώπων. Ως αποτέλεσμα, πολλοί από τους εμβολιασμένους υπέφεραν ή πέθαναν μετά από ένα μαζικό πρόγραμμα εμβολιασμού. (18) Σύμφωνα με τον Επικεφαλής Παθολόγο του Γραφείου του Δημοσίου Εισαγγελέα, 153 από τους εμβολιασμένους με Dengvaxia είχαν πεθάνει στις 18 Φεβρουαρίου 2020. (19)

Ένα άλλο παράδειγμα του κινδύνου της εταιρικής γρήγορης παρακολούθησης των κλινικών δοκιμών ασφάλειας των εμβολίων είναι η περίπτωση του εμβολίου HPV (Human Papilloma Virus). Δύο από τους μεγαλύτερους κατασκευαστές εμβολίων προκάλεσαν ψευδοφάρμακα με ένα νευροτοξικό ανοσοενισχυτικό αλουμινίου και έκοψαν τις περιόδους παρατήρησης.Πολυάριθμες ανεπιθύμητες ενέργειες, συμπεριλαμβανομένων απειλητικών για τη ζωή τραυματισμών, μόνιμων αναπηριών, νοσηλείας και θανάτων, αναφέρθηκαν αργότερα μετά τον εμβολιασμό με δισθενή, τετραδύναμο ή εννέα σθένους εμβόλια HPV. Οι επιστήμονες της εταιρείας συνήθως απέρριπταν, ελαχιστοποιούσαν ή απέκρυβαν αυτούς τους τραυματισμούς χρησιμοποιώντας στατιστικά τεχνάσματα και άκυρες συγκρίσεις που είχαν σχεδιαστεί για να μειώσουν τη σχετική τους σημασία. Ορισμένοι ρυθμιστικοί οργανισμοί συνέβαλαν στην κάλυψη της αυξημένης συχνότητας ανεπιθύμητων ενεργειών σε μελέτες επιτήρησης μετά την κυκλοφορία. (20, 21)

Μια άλλη ανησυχία είναι ότι τα εμβόλια που παράγονται με κυτταρικές καλλιέργειες είναι συχνά μολυσμένα με γυμνά νουκλεϊκά οξέα, γονιδιωματικά θραύσματα, ρετροϊούς και άλλα ξένα υλικά που φέρουν αβέβαιους αλλά δυνητικά σοβαρούς κινδύνους. Αυτή η μόλυνση μπορεί να υπάρχει στο αρχικό υλικό, π.χ. ανθρώπινο αίμα, ανθρώπινους ή ζωικούς ιστούς, τράπεζες κυττάρων ή εισάγονται στη διαδικασία παραγωγής μέσω της χρήσης ορών ζώων. Πολλά υποψήφια εμβόλια COVID-19 παράγονται σε λεγόμενες «αθάνατες» κυτταρικές σειρές ή καρκινικούς τύπους κυττάρων (π.χ. κύτταρα Vero που προέρχονται από την αφρικανική πράσινη μαϊμού) που θα μπορούσαν να εξαπλώσουν υλικό που προάγει τον καρκίνο στον άνθρωπο δέκτη. Οι κατασκευαστές και οι αρχές μας διαβεβαιώνουν ότι αυτά δεν προκαλούν όγκους από μόνα τους. Ωστόσο, επιστημονικές μελέτες μας λένε ότι αφού αυτά τα κύτταρα καλλιεργηθούν επανειλημμένα αρκετές φορές, μπορούν να μετατραπούν σε καρκινική κατάσταση. Οι αθάνατες κυτταρικές σειρές εμφανίζουν 100 φορές μεγαλύτερο αριθμό γεγονότων ανασυνδυασμού DNA σε σύγκριση με τα φυσιολογικά κύτταρα. Αυτό θα μπορούσε να οδηγήσει σε ιογενείς-ιογενείς ή ιογενείς-κυτταρικές αλληλεπιδράσεις που μπορούν να δημιουργήσουν νέους ιούς και να οδηγήσουν σε παθολογικές συνέπειες, συμπεριλαμβανομένης της αυτοανοσίας και του καρκίνου. (22) Ακόμη και ο αμερικανικός FDA αναγνώρισε αυτόν τον κίνδυνο. Σε έγγραφο που δημοσιεύτηκε στον ιστότοπό της, ανέφερε: «Σε ορισμένες περιπτώσεις οι κυτταρικές σειρές που χρησιμοποιούνται μπορεί να είναι ογκογονικές, δηλαδή σχηματίζουν όγκους όταν εγχέονται σε τρωκτικά. Μερικές από αυτές τις κυτταρικές σειρές που σχηματίζουν όγκο μπορεί να περιέχουν ιούς που προκαλούν καρκίνο και δεν αναπαράγονται ενεργά. Τέτοιοι ιοί είναι δύσκολο να εντοπιστούν χρησιμοποιώντας τυπικές μεθόδους. Αυτοί οι λανθάνοντες ή «ήσυχοι» ιοί αποτελούν πιθανή απειλή, καθώς ενδέχεται να δραστηριοποιηθούν υπό συνθήκες παρασκευής εμβολίων». (23)

Μια άλλη ανησυχία, όχι μόνο όσον αφορά τα ζητήματα ασφάλειας αλλά και για ηθικούς λόγους, είναι η χρήση αποβληθέντων εμβρυϊκών κυττάρων στην παρασκευή εμβολίων. Τα εμβόλια που παράγονται από ανθρώπινα εμβρυϊκά κύτταρα περιέχουν υπολείμματα κυττάρων και μολύνουν το εμβρυϊκό DNA (μαζί με την επιγενετική τροποποίησή του), τα οποία δεν μπορούν να εξαλειφθούν πλήρως κατά τον καθοδικό καθαρισμό. Αυτό θα μπορούσε να προκαλέσει μεταλλαξιογένεση παρεμβολής (που μπορεί να προκαλέσει καρκίνο) και αυτοάνοση στους εμβολιασμένους. Τουλάχιστον έξι από τα υποψήφια εμβόλια για τον COVID-19 (Cansino, AstraZeneca/Oxford, Janssen, ImmunityBio/NantKwest, University of Pittsburgh and Altimmune) χρησιμοποιούν μία από τις δύο ανθρώπινες εμβρυϊκές κυτταρικές σειρές: HEK-293, μια νεφρική κυτταρική σειρά που προέρχεται από το έμβρυο αποτράπηκε περίπου το 1972 και PER. Το C6, μια ιδιόκτητη κυτταρική σειρά που ανήκει στον Janssen, δημιουργήθηκε από κύτταρα αμφιβληστροειδούς από ένα έμβρυο 18 εβδομάδων που αποτράπηκε το 1985. (24)

Υπάρχουν πολλοί εύλογοι βιολογικοί μηχανισμοί για πιθανές δυσμενείς επιπτώσεις όλων των εμβολίων που βρίσκονται σε εξέλιξη για τον COVID-19. Το ιστορικό του εμβολιασμού είναι γεμάτο με επιστημονικά στοιχεία ανεπιθύμητων ενεργειών μέσω ενισχυμένης παθογένειας, μετάλλαξης, ανασυνδυασμού, επαγόμενης δυσλειτουργίας του ανοσοποιητικού συστήματος και διαφόρων μη ειδικών επιδράσεων μετά τον εμβολιασμό, παρά την έγκριση των κανονισμών και τις προηγούμενες κλινικές δοκιμές και άλλες μελέτες που υποστηρίζονται από εταιρείες απόδειξη ασφάλειας. Ο εγγενής κίνδυνος από την έγχυση θραυσμάτων μικροβιακής πρωτεΐνης, μολυσματικών ουσιών, DNA και άλλων ξένων υλικών στο ανθρώπινο σώμα είναι καλά τεκμηριωμένος στην επιστημονική βιβλιογραφία. Πρακτικά όλα τα εμβόλια περιέχουν τέτοια επικίνδυνα ξένα θραύσματα και υλικά και είναι αναπόφευκτα μη ασφαλή. Επιπλέον, η έκθεση του εμβολιαζόμενου σε άλλους περιβαλλοντικούς κινδύνους (φυτοκτόνα, ατμοσφαιρικοί ρύποι, ακτινοβολία 5G, ιονίζουσα ακτινοβολία κ.λπ.) που έχει ως αποτέλεσμα συνεργιστικές δυσμενείς επιπτώσεις που δεν έχουν καταγραφεί από μελέτες «ασφάλειας» που χρηματοδοτούνται από εταιρείες είναι επίσης ένας άλλος εύλογος μηχανισμός που μπορεί να οδηγήσει σε οξεία ή μακροχρόνιο τραυματισμό, συμπεριλαμβανομένου του θανάτου.

Οι εκτιμήσεις ασφάλειας στο πλαίσιο του επιστημονικού περιβάλλοντος που κυριαρχείται από τις εταιρείες είναι εξαιρετικά ανεπαρκείς και συχνά εσφαλμένες. Οι προκλινικές μελέτες και οι κλινικές δοκιμές πραγματοποιούνται ή χρηματοδοτούνται από τις ίδιες τις εταιρείες που πωλούν τα εμβόλια και δεν αντιμετωπίζουν επαρκώς τις εύλογες δυσμενείς επιπτώσεις που δεν μπορούν να ανιχνευθούν από τις μελέτες που χρηματοδοτούνται από εταιρείες. Δεν υπάρχουν ανεξάρτητες μελέτες που θα μπορούσαν να επικυρώσουν τους ισχυρισμούς των κατασκευαστών εμβολίων. Ως εκ τούτου, δεν υπάρχει λόγος να πιστεύουμε ότι τα πιθανά οφέλη από ένα επερχόμενο εμβόλιο για τον COVID-19 θα υπερτερούσαν των πιθανών αρνητικών επιπτώσεων, παρά τις διαβεβαιώσεις για την ασφάλεια από τη βιομηχανία εμβολίων, τους διεθνείς οργανισμούς, τις κυβερνήσεις και τις κύριες ομάδες ιατρικής επιστήμης.


Κλινικές δοκιμές εμβολίων COVID-19

Τι είναι η κλινική δοκιμή εμβολίου φάσης 3;

Μια δοκιμή Φάσης 3 ενός ερευνητικού εμβολίου εγγράφει χιλιάδες άτομα για να αξιολογήσουν εάν το εμβόλιο είναι ασφαλές και μπορεί να αποτρέψει αποτελεσματικά τη συμπτωματική νόσο COVID-19. Όλοι οι υποψήφιοι για εμβόλια που δοκιμάζονται σε κλινικές δοκιμές Φάσης 3 που υποστηρίζονται από το OWS έχουν δοκιμαστεί προηγουμένως σε κλινικές δοκιμές πρώιμου σταδίου που έδειξαν ότι ήταν καλά ανεκτοί και προκάλεσαν ανοσοαπόκριση σε ενήλικες εθελοντές. Οι συμμετέχοντες στις κλινικές δοκιμές της Φάσης 3 ανατίθενται τυχαία για να λάβουν είτε το ερευνητικό εμβόλιο είτε ένα εικονικό φάρμακο. Οι δοκιμές είναι διπλά τυφλές, πράγμα που σημαίνει ότι ούτε οι ερευνητές της δοκιμής ούτε οι συμμετέχοντες γνωρίζουν ποιος έλαβε το υποψήφιο εμβόλιο. Οι ερευνητές αξιολογούν εάν το εμβόλιο λειτουργεί συγκρίνοντας τον αριθμό των περιπτώσεων συμπτωματικής COVID-19 στην ομάδα του εμβολίου έναντι της ομάδας εικονικού φαρμάκου. Οι συμμετέχοντες παρακολουθούνται καθ 'όλη τη διάρκεια της δοκιμής για ασφάλεια.

Ποιοι τύποι εμβολίων COVID-19 αξιολογούνται σε δοκιμές μεγάλης κλίμακας στις ΗΠΑ;

Επισκεφτείτε τη σελίδα εμβολίων NIH ACTIV για μια σύνοψη των κλινικών δοκιμών υποψήφιων εμβολίων COVID-19 που υποστηρίζονται από το Operation Warp Speed.

Εμβόλια που βασίζονται σε ιικούς φορείς

Τα υποψήφια εμβόλια που αναπτύχθηκαν από την AstraZeneca και την Οξφόρδη (AZD1222) και την Janssen Pharmaceutical Companies of Johnson & Johnson (JNJ-7843672 ή Ad.26.COV2.S) είναι εμβόλια με βάση ιούς φορείς. Χρησιμοποιούν έναν ασφαλή ιό για να παραδώσουν τον γενετικό κώδικα (DNA) της πρωτεΐνης ακίδας SARS-CoV-2 στα ανθρώπινα κύτταρα, έτσι ώστε τα κύτταρα να μπορούν να παράγουν την πρωτεΐνη. Το JNJ-7843672 χρησιμοποιεί έναν ανθρώπινο αδενοϊό για να παραδώσει τον κώδικα για την πρωτεΐνη ακίδας SARS-CoV-2. Οι αδενοϊοί είναι μια ομάδα ιών που προκαλούν το κοινό κρυολόγημα. Ωστόσο, ο φορέας αδενοϊού που χρησιμοποιείται στον υποψήφιο εμβόλιο έχει τροποποιηθεί έτσι ώστε να μην μπορεί πλέον να αναπαράγεται στους ανθρώπους και να προκαλεί ασθένειες. Ο Janssen χρησιμοποιεί τον ίδιο φορέα στην πρώτη δόση του σχήματος εμβολίου πρώτης ενίσχυσης κατά της νόσου του ιού Έμπολα (Ad26.ZEBOV και MVA-BN-Filo), το οποίο έχει άδεια χρήσης στην Ευρώπη. Το AZD1222 χρησιμοποιεί έναν αδενοϊό χιμπατζή που δεν αναπαράγεται για να παραδώσει τον κώδικα για μια ακίδα πρωτεΐνης SARS-CoV-2. Η τεχνολογία βασίζεται σε ένα εμβόλιο που ανέπτυξε προηγουμένως η Οξφόρδη για τον κορονοϊό αναπνευστικού συνδρόμου της Μέσης Ανατολής (MERS-CoV).

Εμβόλια mRNA

Τα υποψήφια εμβόλια που αναπτύχθηκαν από την Pfizer και την NIH/Moderna είναι εμβόλια mRNA (ριβονουκλεϊκό οξύ αγγελιοφόρου). Όταν ο γενετικός κώδικας (DNA) μιας πρωτεΐνης παραδίδεται σε ένα κύτταρο, αποκωδικοποιείται από το RNA σε αναγνώσιμες οδηγίες. Τα εμβόλια mRNA παραλείπουν αυτό το βήμα παρέχοντας απευθείας στα κύτταρα τις ευανάγνωστες οδηγίες σχετικά με τον τρόπο κατασκευής της πρωτεΐνης αιχμής του SARS-CoV-2. Τα λιπιδικά νανοσωματίδια παραδίδουν το mRNA στο κυτταρόπλασμα του κυττάρου. Το mRNA από ένα εμβόλιο COVID-19 δεν εισέρχεται ποτέ στον πυρήνα του κυττάρου, όπου διατηρείται το DNA μας. Αυτό σημαίνει ότι το mRNA δεν αλλοιώνει ή αλληλεπιδρά με το DNA μας με κανέναν τρόπο και τελικά υποβαθμίζεται μέσα στο κύτταρο ως μέρος του φυσικού κύκλου ζωής του mRNA.

Εμβόλιο υπομονάδας πρωτεΐνης

Το υποψήφιο εμβόλιο που αναπτύχθηκε από τη Novavax, Inc., (NVX CoV2373) είναι ένα εμβόλιο υπομονάδας πρωτεΐνης που περιέχει μια σταθεροποιημένη μορφή της πρωτεΐνης αιχμής SARS-CoV-2 χρησιμοποιώντας την ανασυνδυασμένη τεχνολογία νανοσωματιδίων πρωτεΐνης της εταιρείας. Άλλα εμβόλια για τον COVID-19 υπό ανάπτυξη είναι εμβόλια νουκλεϊκού οξέος που παρέχουν οδηγίες στα κύτταρα να παράγουν την πρωτεΐνη, ενώ τα εμβόλια υπομονάδας πρωτεΐνης παρέχουν απευθείας την πρωτεΐνη.

Πώς ευθυγραμμίζονται οι δοκιμές εμβολίων COVID-19;

Ένα πρωτόκολλο κλινικής δοκιμής αναπτύσσεται από τον χορηγό της δοκιμής και ορίζει γιατί και πώς διεξάγεται η δοκιμή. Το πρωτόκολλο καλύπτει το επιστημονικό σκεπτικό της δοκιμής, τους βασικούς στόχους του, τον σχεδιασμό και τη μεθοδολογία, που μπορούν να εγγραφούν οι πληθυσμοί, πότε και πώς αναλύεται η αποτελεσματικότητα, πώς παρακολουθείται η ασφάλεια, στατιστικά στοιχεία και άλλα ζητήματα.

Όλες οι δοκιμές της Φάσης 3 του OWS είναι τυχαιοποιημένες και ελεγχόμενες με εικονικό φάρμακο, το οποίο είναι το χρυσό πρότυπο για αυστηρή κλινική έρευνα. Οι ειδικοί του NIH, μέσω της εταιρικής σχέσης δημόσιου-ιδιωτικού τομέα Accelerating COVID-19 Therapeutic Interventions and Vaccines (ACTIV), βοήθησαν να διασφαλιστεί ότι τα πρωτόκολλα όλων των δοκιμών Φάσης 3 των ερευνητικών εμβολίων που υποστηρίζονται από το OWS χρησιμοποιούν τις ίδιες εργαστηριακές δοκιμές και έχουν σχεδιαστεί για να αξιολογούν παρόμοια πρωτογενή τελικό σημείο: εάν το εμβόλιο μπορεί να αποτρέψει τη συμπτωματική COVID-19. Αυτή η προσέγγιση επιτρέπει τη διαφανή αξιολόγηση της σχετικής απόδοσης κάθε προσέγγισης εμβολίου σε δοκιμές. Οι δοκιμές μοιράζονται επίσης ένα κοινό συμβούλιο παρακολούθησης δεδομένων και ασφάλειας, έναν ανεξάρτητο φορέα που βρίσκεται εκεί για να επιβλέπει την επιστημονική αυστηρότητα της μελέτης και την ασφάλεια των εθελοντών.

Περισσότερες πληροφορίες σχετικά με την εναρμονισμένη προσέγγιση των κλινικών δοκιμών εμβολίων COVID-19 καλύπτονται από ειδικούς του NIH στο φόρουμ πολιτικής της 29ης Μαΐου 2020 στο περιοδικό Science, με τίτλο "Μια στρατηγική προσέγγιση του εμβολίου COVID-19 R & ampD".

Πόσο καιρό θα χρειαστούν για να ολοκληρωθούν οι δοκιμές;

Κάθε δοκιμή έχει σχεδιαστεί για να παρακολουθεί τους συμμετέχοντες και να συλλέγει δεδομένα ασφάλειας και ανοσογονικότητας για περίπου δύο χρόνια. Ωστόσο, μια δοκιμή μπορεί να διακοπεί προσωρινά ή να διακοπεί λόγω προβλημάτων ασφάλειας, ματαιότητας ή ισχυρών ενδείξεων αποτελεσματικότητας. Είναι δύσκολο να προβλεφθεί ακριβώς πόσος χρόνος θα χρειαστεί για τη δημιουργία αρκετών δεδομένων για τον προσδιορισμό της ασφάλειας και της αποτελεσματικότητας των διαφόρων υποψηφίων εμβολίων, επειδή αυτό εξαρτάται από την πραγματική επίπτωση του SARS-CoV-2, του ιού που προκαλεί τον COVID-19. Οι δοκιμές βασίζονται σε γεγονότα (βάσει περιπτώσεων), πράγμα που σημαίνει ότι οι στατιστικοί εκτιμούν ότι πρέπει να παρατηρηθεί ένας ορισμένος αριθμός περιπτώσεων COVID-19 μεταξύ των συμμετεχόντων στη δοκιμή (περίπου 150-160) για μεγάλη πιθανότητα ανίχνευσης ποσοστιαίας μείωσης της νόσου συχνότητα στην εμβολιασμένη ομάδα σε σύγκριση με την ομάδα του εικονικού φαρμάκου που δεν οφείλεται στην τύχη. Η πρωτογενής ανάλυση πραγματοποιείται μόλις τηρηθεί αυτό το όριο περιπτώσεων. Τα πρωτόκολλα δοκιμής ορίζουν επίσης εάν και πότε η Επιτροπή Παρακολούθησης Δεδομένων και Ασφάλειας (DSMB) μπορεί να πραγματοποιήσει ενδιάμεσες αναλύσεις πριν φτάσει στο σημείο για την κύρια ανάλυση.

Γιατί ορισμένοι πληθυσμοί όπως παιδιά και έγκυες γυναίκες δεν μπορούν να εγγραφούν στις τρέχουσες δοκιμές COVID-19;

Είναι κοινή πρακτική να αξιολογείται πρώτα η ασφάλεια και η αποτελεσματικότητα ενός ερευνητικού εμβολίου σε ενήλικες εθελοντές πριν από την αξιολόγηση σε παιδιά και έγκυες γυναίκες. Ωστόσο, το OWS αναγνωρίζει τη σημασία της προστασίας που προκαλείται από το εμβόλιο σε όλους τους πληθυσμούς, συμπεριλαμβανομένων των παιδιών και των εγκύων γυναικών. Το OWS επιταχύνει τις προκλινικές εκτιμήσεις της πιθανής τοξικότητας στην ανάπτυξη και την αναπαραγωγή για να προβλέψει τυχόν ανησυχίες για την ασφάλεια, όπως συνιστάται σύμφωνα με τις οδηγίες της Υπηρεσίας Τροφίμων και Φαρμάκων. Υποθέτοντας ότι αυτές οι αξιολογήσεις δεν δείχνουν ανησυχίες για την ασφάλεια, η OWS σκοπεύει να διεξάγει μελέτες ασφάλειας και ανοσογονικότητας σε έγκυες γυναίκες και παιδιά, σε συνεργασία με τη βιομηχανία. Οι ανοσοαποκρίσεις σε αυτές τις μελέτες θα συγκρίνονται με τις ανοσολογικές αποκρίσεις από δοκιμές Φάσης 3 σε μη έγκυες ενήλικες (γνωστές ως «ανοσογεφύρωση»).

Πώς λειτουργεί το NIAID για να διασφαλίσει την ποικιλομορφία μεταξύ των εθελοντών στις κλινικές δοκιμές εμβολίων; Γιατί είναι σημαντική η εγγραφή διαφορετικών ομάδων;

Η μακροχρόνια συστημική υγεία και οι κοινωνικές ανισότητες έχουν θέσει πολλούς ανθρώπους από φυλετικές και εθνοτικές μειονότητες σε αυξημένο κίνδυνο να αρρωστήσουν και να πεθάνουν από τον COVID-19. Η φυλή και η εθνικότητα είναι δείκτες κινδύνου για άλλες υποκείμενες συνθήκες που επηρεάζουν την υγεία - συμπεριλαμβανομένης της κοινωνικοοικονομικής κατάστασης, της πρόσβασης στην υγειονομική περίθαλψη και της αυξημένης έκθεσης στον ιό λόγω επαγγέλματος (π.χ., πρώτης γραμμής, βασικοί και κρίσιμοι εργαζόμενοι υποδομής). Σύμφωνα με το CDC, οι άνθρωποι που είναι Μαύροι ή Αφροαμερικάνοι, Ισπανοί ή Λατίνοι, Αμερικανοί Ινδοί ή Αλάσκα ιθαγενείς και Ασιάτες είναι πιο πιθανό να πεθάνουν από τον COVID-19. Οι μαύροι και οι αφροαμερικανοί έχουν 3,7 φορές περισσότερες πιθανότητες να νοσηλευτούν για COVID-19 σε σύγκριση με τους λευκούς. Οι Ισπανόφωνοι ή οι Λατίνοι έχουν 4,1 φορές περισσότερες πιθανότητες να νοσηλευτούν, οι Ινδιάνοι της Αμερικής ή οι ιθαγενείς της Αλάσκας έχουν 4 φορές περισσότερες πιθανότητες να νοσηλευτούν και οι Ασιάτες 1,2 φορές περισσότερες πιθανότητες να νοσηλευτούν.

Είναι σημαντικό οι κλινικές δοκιμές των ΗΠΑ να εγγράφουν έναν εθελοντικό πληθυσμό που αντικατοπτρίζει τουλάχιστον την ποικιλομορφία του πληθυσμού των ΗΠΑ ή, ιδανικά, τον πληθυσμό εκείνων που διατρέχουν αυξημένο κίνδυνο COVID-19.

Το χρηματοδοτούμενο από το NIAID δίκτυο πρόληψης COVID-19 (CoVPN) συνεργάζεται με ενδιαφερόμενα μέρη για να προσεγγίσει πληθυσμούς προτεραιότητας, όπως ιθαγενείς Αμερικανούς, μαύρους Αμερικανούς (συμπεριλαμβανομένων των Αφροαμερικανών), την κοινότητα Latinx, άτομα που διατρέχουν μεγαλύτερο κίνδυνο έκθεσης στον SARS-CoV 2 μόλυνση λόγω επαγγέλματος, άτομα με προϋπάρχουσες συνθήκες υγείας, άτομα που ζουν σε εγκαταστάσεις υποβοηθούμενης διαβίωσης και κοινότητες που αντιμετωπίζουν ανισότητες υγείας.

Η NIH Community Engagement Alliance (CEAL) Against COVID-19 Disparities πραγματοποιεί επικοινωνία και αναζητά πληροφορίες από τις κοινότητες για την ευαισθητοποίηση σχετικά με τον COVID-19 και την αντιμετώπιση της παραπληροφόρησης και της δυσπιστίας σχετικά με την πανδημία και τις προσπάθειες καταπολέμησής της. Η CEAL εργάζεται επίσης για να διασφαλίσει ότι οι κλινικές δοκιμές πρόληψης και θεραπείας του COVID-19 περιλαμβάνουν φυλετικά και εθνοτικά διαφορετικές κοινότητες που επηρεάζονται περισσότερο από την πανδημία.

Τι είναι ο πίνακας παρακολούθησης δεδομένων και ασφάλειας (DSMB); Τι είναι μοναδικό για το εμβόλιο Operation Warp Speed ​​DSMB;

Το DSMB είναι μια ανεξάρτητη ομάδα εμπειρογνωμόνων από διάφορους σχετικούς κλάδους που επιβλέπουν και παρακολουθούν κλινικές δοκιμές για να διασφαλίσουν την ασφάλεια των συμμετεχόντων και την εγκυρότητα και ακεραιότητα των δεδομένων. Οι δοκιμές εμβολίων Φάσης 3 που υποστηρίζονται από OWS επιβλέπονται από ένα κοινό DSMB (που σημαίνει το ίδιο DSMB για πολλαπλές δοκιμές). Το OWS DSMB περιλαμβάνει μέλη με εμπειρία στην ηθική, στατιστικά, ανάπτυξη εμβολίων, φροντίδα ασθενών και κλινικές δοκιμές. Ο ρόλος τους είναι να συμβουλεύουν μια ομάδα που αποτελείται από τον χορηγό της μελέτης, το NIAID και το BARDA.

Τα μέλη του DSMB συνεδριάζουν πριν από κάθε μελέτη αρχίσει να εξετάζει το πρωτόκολλο και το σχέδιο στατιστικής παρακολούθησης. Μετά από αυτό το σημείο, το DSMB συνεδριάζει σύμφωνα με το χρονοδιάγραμμα που καθορίζεται στο πρωτόκολλο. Σε όλες τις τακτικά προγραμματισμένες συναντήσεις, υπάρχει μια ανοιχτή και κλειστή συνεδρίαση. Το DSMB εξετάζει τα ενδιάμεσα και τελικά δεδομένα για την ασφάλεια και την αποτελεσματικότητα σε προκαθορισμένα σημεία καθ' όλη τη διάρκεια μιας μελέτης και κάνει συστάσεις στον χορηγό σχετικά με το εάν ένα πρωτόκολλο πρέπει να τροποποιηθεί ή εάν η μελέτη πρέπει να προχωρήσει ή να διακοπεί ή να τερματιστεί.

Ποιος είναι ο ρόλος της NIAID σε σχέση με το DSMB;

Η NIAID δημιούργησε το OWS DSMB και κάλεσε τα μέλη. Ένας υπάλληλος του NIAID υπηρετεί ως εκτελεστικός γραμματέας.

Το DSMB παρέχει συστάσεις σε μια ομάδα εποπτείας που αποτελείται από τον χορηγό της μελέτης, NIAID και BARDA. Εάν δεν υπάρχει συναίνεση μεταξύ της ομάδας εποπτείας, κάτι που είναι σπάνιο, η τελική απόφαση ανήκει στον χορηγό. Ο διευθυντής NIAID Anthony S. Fauci, M.D., χρησιμεύει ως ο ορισμένος ανώτερος εκπρόσωπος της κυβέρνησης των Ηνωμένων Πολιτειών για την ομάδα εποπτείας. Δεν συμμετέχει στη διαδικασία DSMB για την ανάπτυξη συστάσεων σχετικά με μια κλινική δοκιμή.

Ποιος είναι μέρος του OWS DSMB;

Το DSMB αποτελείται από μια ομάδα εμπειρογνωμόνων από διάφορους σχετικούς κλάδους. Τα ονόματα των μελών του DSMB είναι εμπιστευτικά για την προστασία της ακεραιότητας της διαδικασίας. Η μόνη φορά που κατονομάζονται τα μέλη του DSMB είναι όταν έχει ολοκληρωθεί μια μελέτη και στη συνέχεια, μόνο με τη ρητή άδειά τους, μπορούν να ονομαστούν στην ενότητα ευχαριστιών ενός δημοσιευμένου χειρογράφου για τη μελέτη στην οποία υπηρέτησαν. Κάθε μέλος λαμβάνει ένα μικρό τίμημα για κάθε συνάντηση και είναι υπεύθυνο για την αποκάλυψη τυχόν σύγκρουσης συμφερόντων.

Είναι ασφαλείς οι δοκιμές εμβολίων;

Οι ερευνητές πρώτα αξιολογούν πειραματικά εμβόλια στο εργαστήριο και σε ζωικά μοντέλα. Εάν ένα υποψήφιο εμβόλιο είναι ασφαλές και φαίνεται πολλά υποσχόμενο σε αυτά τα προκλινικά πειράματα, μπορεί να συνεχίσει να ελέγχεται προσεκτικά σε ανθρώπους. Τα πειραματικά εμβόλια υποβάλλονται σε διάφορες φάσεις κλινικών δοκιμών για να διαπιστωθεί η ασφάλεια και η αποτελεσματικότητά τους. Αφού αδειοδοτηθεί ένα εμβόλιο ή εκδοθεί άδεια χρήσης έκτακτης ανάγκης, ο FDA, το CDC και άλλες ομοσπονδιακές υπηρεσίες συνεχίζουν να παρακολουθούν την ασφάλειά του.

Η ανάπτυξη ασφαλών εμβολίων και η διασφάλιση της ασφάλειας των εθελοντών που συμμετέχουν σε κλινικές δοκιμές εμβολίων είναι υψίστης σημασίας. Από τη φύση τους, όλες οι κλινικές δοκιμές περιλαμβάνουν την ανάληψη κάποιου επιπέδου κινδύνου. Ο κίνδυνος που αναλαμβάνουν οι καλά ενημερωμένοι ενήλικες εθελοντές θα μπορούσε να έχει τεράστιο όφελος για την κοινωνία επιταχύνοντας την ανάπτυξη ασφαλών και αποτελεσματικών εμβολίων κατά τη διάρκεια αυτής της πανδημίας. Όλοι οι υποψήφιοι εμβολίων που δοκιμάζονται σε κλινικές δοκιμές Φάσης 3 που υποστηρίζονται από OWS έχουν δοκιμαστεί προηγουμένως σε κλινικές δοκιμές πρώιμου σταδίου στις οποίες βρέθηκε ότι ήταν καλά ανεκτές και προκάλεσαν ανοσολογική απάντηση σε ενήλικες εθελοντές.

Οι άνθρωποι μπορούν να πουν ναι ή όχι όταν κληθούν να συμμετάσχουν σε μια μελέτη υποψηφίου εμβολίου για τον COVID-19. Όλοι οι εθελοντές της μελέτης πρέπει να περάσουν από μια διαδικασία που ονομάζεται ενημερωμένη συγκατάθεση που διασφαλίζει ότι κατανοούν τους πιθανούς κινδύνους και οφέλη από τη συμμετοχή σε μια μελέτη. Μπορούν επίσης να εγκαταλείψουν μια μελέτη ανά πάσα στιγμή. Οι ιστότοποι μελέτης καταβάλλουν κάθε δυνατή προσπάθεια για να διασφαλίσουν ότι οι άνθρωποι κατανοούν πλήρως τη μελέτη προτού αποφασίσουν αν θα συμμετάσχουν. Οι δοκιμές συμμορφώνονται με τους ομοσπονδιακούς κανονισμούς των ΗΠΑ για την έρευνα, καθώς και με τα διεθνή πρότυπα δεοντολογίας.

Οι συμμετέχοντες στις κλινικές δοκιμές παρακολουθούνται πολύ στενά για παρενέργειες που αποδίδονται στο πειραματικό εμβόλιο. Τις περισσότερες φορές, οι παρενέργειες του εμβολίου είναι προσωρινές και μπορεί να περιλαμβάνουν πόνο ή ερυθρότητα στο σημείο της ένεσης και σπανιότερα, πυρετό. Πολύ σπάνια, ένα άτομο μπορεί να εμφανίσει μια σοβαρή ανεπιθύμητη ενέργεια. Οι συμμετέχοντες στις κλινικές δοκιμές λαμβάνουν επίσης συμβουλές σχετικά με τα βήματα που πρέπει να λάβουν για την ελαχιστοποίηση της πιθανότητας μόλυνσης από τον COVID-19 στις κοινότητές τους.

Τι είναι η παύση κλινικής δοκιμής;

Δεν είναι ασυνήθιστο για τις κλινικές δοκιμές να διακόπτουν την εγγραφή όταν συμβαίνει ένα συμβάν ασφάλειας, το οποίο συνέβη με μερικές κλινικές δοκιμές εμβολίων και θεραπευτικών για τον COVID-19. Τα πρωτόκολλα μελέτης οριοθετούν το είδος των συμβάντων ασφάλειας που πρέπει να οδηγήσουν σε ένα επιπλέον επίπεδο αναθεώρησης και σε διακοπή ή παύση κατά τη νέα εγγραφή. Αυτό δείχνει τον βαθμό στον οποίο ενσωματώνονται εγγυήσεις για την ασφάλεια του εθελοντή σε κλινικές δοκιμές. Μια παύση σε μια δοκιμή είναι ένα σημάδι ότι το σύστημα λειτουργεί. Ένας χορηγός μελέτης αποφασίζει να ξεκινήσει μια παύση.

Τι είναι μια κλινική εκμετάλλευση;

Ένας άλλος τύπος διακοπής της μελέτης είναι γνωστός ως κλινικός έλεγχος. Ο Οργανισμός Τροφίμων και Φαρμάκων (FDA) επιβλέπει τη διεξαγωγή κλινικών δοκιμών στις ΗΠΑ και μπορεί να εκδώσει κλινική κράτηση, απαιτώντας από τον χορηγό να απαντήσει σε διάφορες ερωτήσεις πριν συνεχιστεί η δοκιμή.

Τι συμβαίνει αφού μια κλινική δοκιμή Φάσης 3 διαπιστώσει ότι ένα εμβόλιο είναι ασφαλές και αποτελεσματικό;

Μια κλινική δοκιμή πρέπει πρώτα να καθορίσει την ασφάλεια και την αποτελεσματικότητα ενός υποψηφίου εμβολίου προτού καταστεί ευρέως διαθέσιμο.Οποιοσδήποτε υποψήφιος για εμβόλιο COVID-19 θα ακολουθήσει αυτή τη διαδικασία προτού τα άτομα μπορέσουν να λάβουν το εμβόλιο εκτός κλινικής δοκιμής:

  1. Καθιερωμένη ασφάλεια και αποτελεσματικότητα
  2. Ο FDA αναθεωρεί και εξουσιοδοτεί
  3. Το CDC εκδίδει συστάσεις για τη χρήση εμβολίων
  4. Το εμβόλιο διανέμεται

Καθιερωμένη ασφάλεια και αποτελεσματικότητα

Το Συμβούλιο Παρακολούθησης Δεδομένων και Ασφάλειας (DSMB) εξετάζει τα δεδομένα των δοκιμών και ενημερώνει τον χορηγό, NIH και BARDA ότι η δοκιμή έχει φτάσει σε ένα προκαθορισμένο «σημείο στάσης» για την αποτελεσματικότητα. Αυτό σημαίνει ότι υπάρχουν αρκετά στοιχεία που δείχνουν ότι το εμβόλιο μπορεί να αποτρέψει αποτελεσματικά τη συμπτωματική COVID-19 στους συμμετέχοντες. Ακόμα κι αν επιτευχθεί ένα «σημείο στάσης», το δοκιμαστικό προσωπικό θα συνεχίσει να ακολουθεί τους συμμετέχοντες και μπορεί να παραμείνει τυφλό. Επιπλέον, οι δοκιμές εξακολουθούν να επιτρέπουν επαρκή χρόνο για να διασφαλιστεί ότι θα συλλεχθούν αρκετά δεδομένα ασφάλειας πριν διανεμηθεί ευρέως ένα εμβόλιο. Το DSMB θα διαδραματίσει βασικό ρόλο στην παροχή συμβουλών σχετικά με τον τρόπο με τον οποίο μια δοκιμή θα πρέπει να προχωρήσει με ηθικό τρόπο όταν επιτευχθεί ένα σημείο στάσης.

Ο FDA αναθεωρεί και εξουσιοδοτεί

Το Κέντρο Βιολογικών Αξιολόγησης και Έρευνας (CBER) του FDA είναι υπεύθυνο για τη ρύθμιση των εμβολίων στις Ηνωμένες Πολιτείες. Εάν είναι επιτυχής, η ολοκλήρωση και των τριών φάσεων κλινικής ανάπτυξης μπορεί να ακολουθηθεί από αίτημα για Άδεια Χρήσης Έκτακτης Ανάγκης (EUA) ή υποβολή Αίτησης Άδειας Βιολογικών Προϊόντων (BLA).

Η συμβουλευτική επιτροπή εμβολίων CBER και σχετικών βιολογικών προϊόντων (VRBPAC) συνεδρίασε τον Οκτώβριο του 2020 για να συζητήσει, γενικά, την ανάπτυξη, την έγκριση και/ή την αδειοδότηση εμβολίων για την πρόληψη του COVID-19. Αυτή η επιτροπή εμπειρογνωμόνων εκτός FDA (επιστήμονες, γιατροί, βιοστατιστικοί και εκπρόσωπος καταναλωτών) παρέχει συμβουλές στον FDA σχετικά με την ασφάλεια και την αποτελεσματικότητα του εμβολίου για την προτεινόμενη ένδειξη. Το VRBPAC εξετάζει αιτήματα για EUA και αιτήσεις αδειών για όλα τα εμβόλια COVID-19. Ανατρέξτε στην Επεξήγηση της Εξουσιοδότησης Χρήσης Έκτακτης Ανάγκης για Εμβόλια του FDA για περισσότερες πληροφορίες.

Το CDC εκδίδει συστάσεις για τη χρήση εμβολίων

Το CDC κάνει συστάσεις για τον εμβολιασμό COVID-19 για τις Ηνωμένες Πολιτείες με βάση τη συμβολή της Συμβουλευτικής Επιτροπής για τις Πρακτικές Ανοσοποίησης (ACIP). Το ACIP είναι μια ομοσπονδιακή συμβουλευτική επιτροπή αποτελούμενη από ιατρούς και ειδικούς στη δημόσια υγεία που αναπτύσσουν συστάσεις για τη χρήση εμβολίων στο κοινό των ΗΠΑ.

Εάν η Υπηρεσία Τροφίμων και Φαρμάκων (FDA) εγκρίνει ή εγκρίνει ένα εμβόλιο COVID-19, το ACIP συνέρχεται για να αναθεωρήσει όλα τα διαθέσιμα δεδομένα σχετικά με αυτό το εμβόλιο. Από αυτά τα δεδομένα, το ACIP θα ψηφίσει στη συνέχεια εάν θα συστήσει το εμβόλιο και για ποιους πληθυσμούς. Οι συστάσεις του ACIP περιλαμβάνουν επίσης καθοδήγηση σχετικά με το ποιος πρέπει να λάβει εμβόλια κατά του COVID-19 εάν η προσφορά είναι περιορισμένη. Οι συστάσεις πρέπει να πάνε στον διευθυντή του CDC για έγκριση πριν γίνουν επίσημη πολιτική CDC.

Το εμβόλιο διανέμεται

Το CDC, σύμφωνα με την αρχική καθοδήγηση από το ACIP, έχει περιγράψει τους πληθυσμούς προτεραιότητας που θα λάβουν πρώτα το εμβόλιο. Γενικά, θα χρειαστούν αρκετοί μήνες πριν τα εμβόλια κατά του COVID-19 είναι ευρέως διαθέσιμα στο ευρύ κοινό.

Το Υπουργείο Άμυνας βοηθά στον συντονισμό της εφοδιαστικής διανομής εμβολίων στις Ηνωμένες Πολιτείες. Ενώ το Υπουργείο Άμυνας επιβλέπει αυτή τη διαδικασία, είναι σημαντικό να σημειωθεί ότι το στρατιωτικό προσωπικό δεν θα εμβολιάζει σωματικά τους ανθρώπους στις ΗΠΑ, αν και ορισμένες πολιτείες ενδέχεται να επιλέξουν να χρησιμοποιήσουν το ιατρικό σώμα της Εθνικής Φρουράς τους για βοήθεια.

Το CDC σημειώνει ότι η ομοσπονδιακή κυβέρνηση θα επιβλέπει ένα κεντρικό σύστημα παραγγελίας, διανομής και παρακολούθησης εμβολίων COVID-19. Όλα τα εμβόλια θα παραγγελθούν μέσω του CDC. Οι πάροχοι εμβολίων θα λαμβάνουν εμβόλια από τον κεντρικό διανομέα του CDC ή απευθείας από έναν κατασκευαστή εμβολίων. Για περισσότερες πληροφορίες, ανατρέξτε στην ενότητα Συχνές ερωτήσεις σχετικά με τον εμβολιασμό κατά του COVID-19.

Πώς συνέβαλε η έρευνα NIAID στην πρώιμη ανάπτυξη των εμβολίων COVID-19 τώρα σε κλινικές δοκιμές σε τελευταίο στάδιο;

Με βάση προηγούμενες έρευνες σχετικά με το SARS και το MERS, οι επιστήμονες και οι υποψήφιοι του NIAID τοποθετήθηκαν για να αναπτύξουν γρήγορα τα εμβόλια, τα θεραπευτικά και τα διαγνωστικά για τον COVID-19. Αυτά τα έργα περιλαμβάνουν τη διεξαγωγή βασικής έρευνας για να κατανοήσουμε πώς ο ιός μολύνει τα κύτταρα και προκαλεί ασθένειες και ποιες παρεμβάσεις μπορούν να αποτρέψουν και να σταματήσουν την εξάπλωση της νόσου.

Οι επιστήμονες στο Κέντρο Ερευνών Εμβολίων της NIAID στη Bethesda του Μέριλαντ έχουν περάσει χρόνια ερευνώντας τη δομή και τη λειτουργία των κορωνοϊών για τη δημιουργία εμβολίων υψηλής στόχευσης. Μαζί με τους ακαδημαϊκούς συνεργάτες τους, η κεντρική εργασία τους πριν από την πανδημία του COVID-19 αποκάλυψε ότι μια σταθεροποιημένη έκδοση της πρωτεΐνης αιχμής που βρίσκεται στην επιφάνεια όλων των κορωνοϊών μπορεί να αποτελέσει βασικό στόχο για εμβόλια, θεραπευτικά και διαγνωστικά. Όλα τα σωματίδια του κορωνοϊού είναι σφαιρικά και έχουν πρωτεΐνες σε σχήμα μανιταριού που ονομάζονται αιχμές που προεξέχουν από την επιφάνειά τους, δίνοντας στα σωματίδια μια εμφάνιση που μοιάζει με κορώνα. Η ακίδα συνδέεται και συγχωνεύεται με τα ανθρώπινα κύτταρα, επιτρέποντας στον ιό να εισέλθει. Ωστόσο, η ακίδα υφίσταται μια τεράστια αναδιάταξη καθώς συγχωνεύει τον ιό και τις κυτταρικές μεμβράνες. Οι ερευνητές του VRC και οι συνεργάτες τους (Andrew Ward στο Scripps και Jason McLellan στο Dartmouth) έλυσαν τη δομή της ακίδας. Το VRC και ο Δρ. McLellan (τώρα στο Πανεπιστήμιο του Τέξας, Ώστιν) ανακάλυψαν ότι η ακίδα που σταθεροποιήθηκε στη διάταξή της προσύγχυσης είναι πιο πιθανό να διατηρήσει στόχους για αντισώματα που εμποδίζουν τη μόλυνση που προκαλούνται από ένα εμβόλιο. Χάρη σε χρόνια προηγούμενης έρευνας, όταν το γονιδίωμα ενός απομονωμένου ιού SARS-CoV-2 μοιράστηκε από ερευνητές στην Κίνα στις αρχές του 2020, οι επιστήμονες του NIAID VRC και οι συνεργάτες τους στο UT μπόρεσαν να επιβεβαιώσουν γρήγορα ότι ο SARS-CoV-2 σταθεροποίησε την πρόφαση Η πρωτεΐνη ακίδας θα ήταν υποψήφιο αντιγόνο εμβολίου. Η έρευνά τους που αποκαλύπτει τη δομή ατομικού επιπέδου της πρωτεΐνης ακίδας SARS-CoV-2 υποστηρίζει την ανακάλυψη αντιιικών θεραπευτικών, εκτός από τον σχεδιασμό εμβολίου ακριβείας.

Επιστήμονες της NIAID που εδρεύουν στα Rocky Mountain Laboratories στο Hamilton της Μοντάνα, συνεργάζονται επίσης με ερευνητές του Πανεπιστημίου της Οξφόρδης για τη διενέργεια προκλινικών μελετών σε υποψήφιο εμβόλιο με χιμπατζή της Οξφόρδης εναντίον του MERS-CoV και γρήγορα μετάβαση σε προκλινικές μελέτες του υποψηφίου της Οξφόρδης για SARS-CoV- 2 (AZD1222), τώρα με άδεια στην AstraZeneca για περαιτέρω ανάπτυξη.

Πώς μπορώ να γίνω εθελοντής για κλινική δοκιμή εμβολίου COVID-19;

Όσοι ενδιαφέρονται να συμμετάσχουν σε μια κλινική δοκιμή εμβολίου COVID-19 μπορούν να επισκεφθούν το preventcovid.org.

Πού μπορώ να βρω περισσότερες πληροφορίες σχετικά με τη συμμετοχή σε κλινική δοκιμή θεραπείας για COVID-19;

Όσοι ενδιαφέρονται να συμμετάσχουν σε κλινικές δοκιμές COVID-19 μπορούν να επισκεφθούν τη διεύθυνση https://combatcovid.hhs.gov/.

Πότε οι συμμετέχοντες στις δοκιμές εμβολίων Moderna και Pfizer/BioNTech που έλαβαν εικονικό φάρμακο θα αποκτήσουν πρόσβαση στο εμβόλιο;

Οι χορηγοί της μελέτης (Moderna και Pfizer/BioNTech), σε συνεννόηση με τον FDA, καταρτίζουν σχέδια για να προσφέρουν τα εμβόλια σε συμμετέχοντες που τυχαιοποιήθηκαν να λάβουν εικονικό φάρμακο στο πλαίσιο της δοκιμής. Επικοινωνήστε απευθείας με τους χορηγούς μελέτης για περισσότερες πληροφορίες.

Θα συνεχιστούν οι ελεγχόμενες με εικονικό φάρμακο δοκιμές άλλων υποψηφίων για εμβόλια COVID-19 μόλις τα εμβόλια Moderna και Pfizer λάβουν EUA; Θα ξεκινήσουν νέες ελεγχόμενες με εικονικό φάρμακο δοκιμές;

Επιπρόσθετες δοκιμές με εικονικό φάρμακο που υποστηρίζονται από το Operation Warp Speed ​​που ξεκίνησαν πριν από τη διάθεση των εμβολίων Moderna και Pfizer/BioNTech εξακολουθούν να βρίσκονται σε εξέλιξη. Οι δοκιμές αξιολογούν ερευνητικά εμβόλια που αναπτύχθηκαν από την AstraZeneca και την Janssen Pharmaceutical Companies της Johnson & Johnson.

Μια άλλη δοκιμή που υποστηρίζεται από το Operation Warp Speed ​​αξιολογεί ένα ερευνητικό εμβόλιο για τον COVID-19 που αναπτύχθηκε από την εταιρεία βιοτεχνολογίας Novavax, Inc., ξεκίνησε στα τέλη Δεκεμβρίου 2020. Είναι σημαντικό να συνεχίσουμε να διεξάγουμε αυστηρές δοκιμές πολλαπλών τύπων εμβολίων COVID-19 για να διασφαλίσουμε ότι έχουν μια σειρά από επιλογές. Οι προφυλάξεις που ταιριάζουν σε όλους δεν παρέχουν πάντα την καλύτερη εφαρμογή για όλους. Τα εμβόλια κατά του COVID-19 που διατίθενται αρχικά σε ορισμένους πληθυσμούς προτεραιότητας εγκρίνονται από την Υπηρεσία Τροφίμων και Φαρμάκων στο πλαίσιο ενός μηχανισμού που είναι γνωστός ως Εξουσιοδότηση Χρήσης Έκτακτης Ανάγκης (EUA). Η έκδοση ενός EUA είναι διαφορετική από την έγκριση (άδεια) ενός εμβολίου από την FDA. Ένα εμβόλιο που διατίθεται με άδεια χρήσης έκτακτης ανάγκης εξακολουθεί να θεωρείται υπό διερεύνηση. Μια ελεγχόμενη με εικονικό φάρμακο δοκιμή παραμένει κατάλληλη έως ότου ένα εμβόλιο COVID-19 εγκριθεί για χρήση και είναι ευρέως διαθέσιμο στις Η.Π.Α.


ΣΥΜΠΛΗΡΩΜΑΤΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ

Συμπληρωματικός πίνακας 1: Αποτελέσματα βαθμολόγησης για όλα τα δολώματα και όλες τις πρωτεΐνες

Συμπληρωματικός πίνακας 2: Αλληλεπιδράσεις υψηλής εμπιστοσύνης SARS-CoV 2

Συμπληρωματικός πίνακας 3: Φάρμακα και αντιδραστήρια που προέρχονται από βιβλιογραφία που ρυθμίζουν τους αλληλεπιδράσεις SARS-Cov-2. Συσχετίσεις στόχων φαρμάκων που προέρχονται από χημειοπληροφορικές αναζητήσεις της βιβλιογραφίας, συμπεριλαμβανομένων πληροφοριών σχετικά με την αγοραστική δυνατότητα

Συμπληρωματικός πίνακας 4: Φάρμακα και αντιδραστήρια που προσδιορίζονται από ειδικούς που ρυθμίζουν τους αλληλεπιδράσεις SARS-CoV-2. Ενώσεις-στόχοι φαρμάκων που προέρχονται από εξειδικευμένη γνώση των αλληλεπιδραστών ανθρώπινης πρωτεΐνης του SARS-Co-V2 και αντιδραστηρίων και φαρμάκων που τα διαμορφώνουν, που δεν είναι άμεσα διαθέσιμα από τη βιβλιογραφία με χημειοπληροφορική αναζήτηση

Συμπληρωματικός πίνακας 5: Ακατέργαστες χημικές συσχετίσεις με πρωτεΐνες θηράματος IUPHAR/BPS Οδηγός Φαρμακολογίας (2020-3-12)

Συμπληρωματικός πίνακας 6: Ακατέργαστες χημικές συσχετίσεις με πρωτεΐνες θηράματος ChEMBL25

Συμπληρωματικές μέθοδοι: Υπολογιστικές μέθοδοι που χρησιμοποιούνται για τη διάδοση πινάκων και συμπληρωματικών αριθμών

Συμπληρωματική συζήτηση: Εξετάστε σε βάθος τα μεμονωμένα υποδίκτυα δολωμάτων SARS-CoV-2


Δες το βίντεο: #Κορωνοϊός: Τα είδη εμβολίων, τα φάρμακα, οι αλλεργικοί και οι καπνιστές (Οκτώβριος 2022).