Πληροφορίες

Πώς είναι τα αμινοξέα ουδέτερα στο φυσιολογικό pH;

Πώς είναι τα αμινοξέα ουδέτερα στο φυσιολογικό pH;


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Τα αμινοξέα με μη ιονιζόμενες πλευρικές αλυσίδες είναι αμφιτεριόντα όταν βρίσκονται σε φυσιολογικό pH, pH 7,4. Αυτό λέει το βιβλίο μου. Αλλά δεν καταλαβαίνω γιατί. Το Pka για μια καρβοξυλομάδα είναι περίπου 3 και το pKa για μια αμινομάδα είναι περίπου 9. Άρα το ισοηλεκτρικό σημείο θα πρέπει να είναι περίπου (9+3) /2 = 6 για ένα αμινοξύ χωρίς ιονιζόμενη πλευρική αλυσίδα. Σε pH 7,4 θα ήταν ελαφρώς αρνητικό, έτσι δεν είναι;

Επίσης τι ακριβώς είναι ένα βασικό αμινοξύ; Είναι αμινοξύ που έχει τιμή PI μεγαλύτερη από 7;

Σας ευχαριστώ.


Έχετε δίκιο, τα περισσότερα από τα αμινοξέα έχουν pI γύρω στο 6, επομένως είναι ελαφρώς αρνητικά σε pH 7.

Το ισοηλεκτρικό σημείο εξαρτάται από τις ομάδες αμινοξέος και καρβοξυλικού οξέος και τις ομάδες της πλευρικής αλυσίδας. Π.χ. Η λυσίνη έχει μια αμινομάδα στην πλευρική αλυσίδα, επομένως έχει ένα pI 9,74.


Εάν ένα αμινοξύ έχει δύο αμινομάδες και μόνο μία καρβοξυλομάδα (όπως αργινίνη και λυσίνη), τότε είναι θετικά φορτισμένα (++ έναντι -) σε ουδέτερο pH. Από την άλλη πλευρά, εάν τα αμινοξέα έχουν δύο καρβοξυλομάδες και μόνο μία αμινομάδα (όπως το γλουταμινικό οξύ και το ασπαρτικό οξύ), είναι αρνητικά φορτισμένα σε pH7 (-- έναντι +). Δεν έχετε δίκιο ότι οι ομάδες είναι πραγματικά ουδέτερες. Η καρβοξυλική ομάδα είναι αρνητικά φορτισμένη σε διάλυμα πολύ υψηλότερο από το pKa της καρβοξυλικής ομάδας (που είναι pH 2,48 για την αργινίνη). Το ίδιο ισχύει για τις αμινομάδες (το pKb είναι σε pH 11,5 για την αργινίνη). Έτσι, σε pH 9,5, η αναλογία της θετικά φορτισμένης αμινομάδας προς μια ουδέτερη αμινομάδα είναι 100:1 (στο pKb θα ήταν 50:50). Σε ρΗ 4,48, η καρβοξυλική ομάδα της αργινίνης θα ήταν αρνητικά φορτισμένη 1:100, έναντι ουδέτερης. Έτσι, σε pH7, όλη η καρβοξυλομάδα είναι αρνητικά φορτισμένη (COO-) και όλες οι αμινομάδες (2 από αυτές) είναι πλήρως θετικά φορτισμένες (NH3+). Η καθαρή χρέωση είναι συν 1, στην περίπτωση της αργινίνης σε pH 7.


Σε pH 7,4 μια καρβοξυλική ομάδα υπάρχει κυρίως ως COO-, ενώ μια αμινομάδα υπάρχει ως ΝΗ3+. Έτσι, όταν ένα μόριο έχει και τις δύο ομάδες, όπως ένα αμινοξύ, το μόριο ως σύνολο είναι ουδέτερο. Καθώς είναι Zwitterion (ίσα φορτία + και -), το υδρογόνο μπορεί επίσης να κάνει flip flop μεταξύ αμινο και καρβοξυλικής ομάδας. Κάνοντας το μόριο «πραγματικά» ουδέτερο καθώς και οι δύο ομάδες δεν είναι φορτισμένες.

Ένα βασικό αμινοξύ έχει μια βασική ομάδα όπως μια αμινομάδα (Αργινίνη) στην πλευρική του αλυσίδα.


Τεχνικά ναι, τα περισσότερα αμινοξέα θα είναι ελαφρώς αρνητικά φορτισμένα σε φυσιολογικό pH. Αλλά πρέπει να καταλάβουμε τι σημαίνει αυτό. Ας πάρουμε για παράδειγμα την αλανίνη. Οποιοδήποτε μεμονωμένο μόριο αλανίνης μπορεί είτε να είναι αφόρτιστο είτε να έχει ακέραιο καθαρό φορτίο - είτε είναι πρωτονιωμένο είτε όχι. Δεν θα βρείτε ποτέ ένα «μερικώς φορτισμένο» μόριο αλανίνης. Ωστόσο, εάν έχετε ένα σωρό μόρια αλανίνης σε φυσιολογικό pH διαλύματος, δεν θα συμπεριφέρονται όλα με τον ίδιο ακριβώς τρόπο ακριβώς την ίδια στιγμή. Ένα μόριο μπορεί να έχει πρωτονιωμένο Ν-άκρο ενώ ένα άλλο έχει αποπρωτονιωμένο Ν-άκρο. Σε φυσιολογικό pH, το καρβοξυτελικό άκρο είναι σχεδόν εντελώς αποπρωτονιωμένο, επομένως πρέπει απλώς να δώσουμε προσοχή στο Ν-άκρο. Μπορούμε να χρησιμοποιήσουμε την εξίσωση Henderson-Hasselbach για να υπολογίσουμε ποιο ποσοστό των μορίων αλανίνης θα έχουν πρωτονιωμένο (θετικά φορτισμένο) Ν-άκρο και ποιο ποσοστό αποπρωτονιώνεται. pH = pKa + log (αποπρωτονιωμένο/πρωτονιωμένο). Αν αντικαταστήσουμε τους γνωστούς μας αριθμούς, παίρνουμε 7,4 = 9,5 + log (αποπρωτονιωμένο/πρωτονιωμένο)

Επομένως -2,1 = log(deprot/prot) και 10^-2,1 = deprot/prot = 0,008. Αυτό σημαίνει ότι από τα 1000 μόρια αλανίνης, περίπου 8 από αυτά είναι αποπρωτονιωμένα και επομένως φορτισμένα αρνητικά. Τα άλλα 992 είναι αμφιτερόνια. Έτσι για όλες τις προθέσεις και τους σκοπούς η αλανίνη είναι ουδέτερη σε φυσιολογικό pH.


9.3: Αμινοξέα, πρωτεΐνες και pH

Εκτός από την εξέταση του τρόπου με τον οποίο η προσθήκη ισχυρού οξέος ή βάσης επηρεάζει ένα ρυθμιστικό διάλυμα, μπορούμε επίσης να εξετάσουμε την επίδραση του pH σε ένα συγκεκριμένο οξύ ή βάση. Αυτό είναι ιδιαίτερα σημαντικό σε βιολογικά συστήματα όπου υπάρχουν πολλές ομάδες ασθενών οξέων ή βάσεων που μπορούν να επηρεαστούν από το pH. Για παράδειγμα, οι πρωτεΐνες περιέχουν ασθενώς όξινο &ndashCOOH και ασθενώς βασικό &ndashNH2 ομάδες. Ένα διάλυμα 1,0 Μ απλού καρβοξυλικού οξέος όπως το οξικό οξύ έχει pH ίσο

2.8 Αποδεικνύεται ότι τα περισσότερα καρβοξυλικά οξέα συμπεριφέρονται με παρόμοιο τρόπο. Εάν χειριστούμε το pH, για παράδειγμα, προσθέτοντας μια ισχυρή βάση, το οξικό οξύ αντιδρά με τη βάση για να σχηματίσει ένα οξικό ιόν. Με βάση την εξίσωση Henderson&ndash Hasselbalch, όταν [οξικό] = [οξικό οξύ], το pH ισούται με το οξύ&rsquos pKένα, που είναι 4,74. Καθώς το pH αυξάνεται, η συγκέντρωση του οξικού πρέπει επίσης να αυξηθεί, μέχρι το pH

7 (περίπου φυσιολογικό φυσιολογικό pH). Σε αυτό το σημείο η συγκέντρωση του οξικού οξέος είναι πράγματι πολύ μικρή. Η αναλογία βάσης προς οξύ είναι περίπου 200/1. Δηλαδή, σε φυσιολογικά pH ομάδες όπως τα καρβοξυλικά οξέα αποπρωτονιώνονται και υπάρχουν στην καρβοξυλική (αρνητικά φορτισμένη) μορφή.

Αντίθετα, αν δούμε την αμινομάδα (&ndashNH2) μιας πρωτεΐνης, είναι στην πραγματικότητα το τμήμα βάσης ενός συζυγούς ζεύγους οξέος-βάσης στο οποίο το οξύ είναι η πρωτονιωμένη μορφή &ndashNH3 + . Το pKένα μιας ομάδας &ndashNH3+ είναι συνήθως

9. Σε pH 9 υπάρχουν ίσες ποσότητες πρωτονιωμένων (&ndash NH2) και μη πρωτονιωμένες μορφές (&ndashNH3 + ). Αν λοιπόν αλλάξουμε το pH προσθέτοντας ένα οξύ, η συγκέντρωση του &ndash NH3 Η φόρμα + αυξάνεται καθώς η βασική μορφή &ndashNH2 πρωτονιώνεται. Σε pH

7 υπάρχει λίγο από το &ndashNH2 μορφή που απομένει.

Είναι ενδιαφέρον ότι αυτό σημαίνει ότι ένα αμινοξύ (που φαίνεται στο σχήμα) δεν υπάρχει ποτέ σε μια κατάσταση όπου και το αμινοξύ (&ndashNH2) ομάδα και το καρβοξυλικό οξύ (&ndashCO2Η) υπάρχουν ταυτόχρονα. Το είδος &ldquoneutral&rdquo είναι στην πραγματικότητα αυτό στο οποίο &ndashNH3 + /&ndashCO2 &ndash υπάρχουν. Αυτό το αμφιτεριόν (δηλαδή ένα ουδέτερο μόριο με θετικό και αρνητικό ηλεκτρικό φορτίο σε διαφορετικές θέσεις, από το γερμανικό zwitter, που σημαίνει &ldquobetween&rdquo) είναι η κυρίαρχη μορφή στο φυσιολογικό pH.

Μια πρωτεΐνη αποτελείται κυρίως (μερικές φορές αποκλειστικά) από πολυμερή αμινοξέων, γνωστά ως πολυπεπτίδια. Σε ένα πολυπεπτίδιο, το αμινο (&ndashNH2) και καρβοξυλικό οξύ (&ndashCO2Η) ομάδες αμινοξέων συνδέονται μεταξύ τους για να σχηματίσουν έναν πεπτιδικό δεσμό (βλέπε σχήμα).

Η προκύπτουσα αμιδική ομάδα (πεπτιδικός δεσμός) δεν είναι ούτε όξινη ούτε βασική υπό φυσιολογικές συνθήκες 182 . Τούτου λεχθέντος, πολλά από τα αμινοξέα που βρίσκονται στις πρωτεΐνες έχουν όξινες (ασπαρτικό οξύ ή γλουταμινικό οξύ) ή βασικές (λυσίνη, αργινίνη ή ιστιδίνη) πλευρικές αλυσίδες. Το pH του περιβάλλοντος επηρεάζει τις διαμορφώσεις του μορίου της πρωτεΐνης και τις αλληλεπιδράσεις μεταξύ αυτών των φορτισμένων πλευρικών αλυσίδων (οι αυθόρμητες φυσικές διαμορφώσεις του μορίου ονομάζονται αναδίπλωση πρωτεΐνης). Οι αλλαγές από το περιβάλλον &ldquonormal&rdquo μπορεί να οδηγήσουν σε αλλαγές στη δομή της πρωτεΐνης και αυτό με τη σειρά του μπορεί να αλλάξει τη βιολογική δραστηριότητα. Σε ορισμένες περιπτώσεις, η πρωτεϊνική δραστηριότητα ρυθμίζεται από το περιβαλλοντικό pH. Σε άλλες περιπτώσεις, οι αλλαγές στο pH μπορεί να οδηγήσουν σε κακή αναδίπλωση της πρωτεΐνης (ή μετουσίωση, η οποία σε ζωντανούς οργανισμούς μπορεί να προκαλέσει διακοπή της κυτταρικής δραστηριότητας ή θάνατο). Για παράδειγμα,: εάν αυτές οι ομάδες είναι πρωτονιωμένες ή αποπρωτονιωμένες, το ηλεκτρονικό περιβάλλον σε αυτήν την περιοχή της πρωτεΐνης μπορεί να αλλάξει δραστικά, πράγμα που μπορεί να σημαίνει ότι η πρωτεΐνη όχι μόνο θα αλλάξει τον τρόπο αλληλεπίδρασής της με άλλα είδη, αλλά το σχήμα της μπορεί να αλλάξει έτσι ώστε να ελαχιστοποιηθεί απωθητικές αλληλεπιδράσεις ή παράγουν νέες ελκυστικές αλληλεπιδράσεις. Μικρές αλλαγές στο σχήμα της πρωτεΐνης μπορεί να έχουν βαθιές επιπτώσεις στον τρόπο με τον οποίο η πρωτεΐνη αλληλεπιδρά με άλλα μόρια και, εάν είναι καταλύτης, στην αποτελεσματικότητα και την ειδικότητά της. Μάλιστα, υπάρχουν περιπτώσεις όπου το περιβαλλοντικό pH χρησιμοποιείται για τη ρύθμιση της πρωτεϊνικής δραστηριότητας.


Ταξινόμηση

Εκτός από τις αμινο και καρβοξυλομάδες, τα αμινοξέα έχουν μια πλευρική αλυσίδα ή ομάδα R συνδεδεμένη με τον &άλφα άνθρακα. Κάθε αμινοξύ έχει μοναδικά χαρακτηριστικά που προκύπτουν από το μέγεθος, το σχήμα, τη διαλυτότητα και τις ιδιότητες ιονισμού της ομάδας R του. Ως αποτέλεσμα, οι πλευρικές αλυσίδες των αμινοξέων ασκούν βαθιά επίδραση στη δομή και τη βιολογική δραστηριότητα των πρωτεϊνών. Αν και τα αμινοξέα μπορούν να ταξινομηθούν με διάφορους τρόπους, μια κοινή προσέγγιση είναι να ταξινομηθούν ανάλογα με το εάν η λειτουργική ομάδα στην πλευρική αλυσίδα σε ουδέτερο pH είναι μη πολική, πολική αλλά αφόρτιστη, αρνητικά φορτισμένη ή θετικά φορτισμένη. Οι δομές και τα ονόματα των 20 αμινοξέων, οι συντομογραφίες τους ενός και τριών γραμμάτων και μερικά από τα διακριτικά τους χαρακτηριστικά δίνονται στον Πίνακα (PageIndex<1>).

Πίνακας (PageIndex<1>): Κοινά αμινοξέα που βρίσκονται στις πρωτεΐνες
Συνηθισμένο όνομα Συντομογραφία Δομικός τύπος (σε pH 6) Μοριακή μάζα Διακριτικό χαρακτηριστικό
Αμινοξέα με μη πολική ομάδα R
γλυκίνη gly (G) 75 το μόνο αμινοξύ που στερείται χειρόμορφου άνθρακα
αλανίνη αλά (Α) 89 &mdash
βαλίνη val (V) 117 ένα αμινοξύ διακλαδισμένης αλυσίδας
λευκίνη leu (L) 131 ένα αμινοξύ διακλαδισμένης αλυσίδας
ισολευκίνη ile (εγώ) 131 ένα απαραίτητο αμινοξύ επειδή τα περισσότερα ζώα δεν μπορούν να συνθέσουν αμινοξέα διακλαδισμένης αλυσίδας
φαινυλαλανίνη phe (F) 165 ταξινομείται επίσης ως αρωματικό αμινοξύ
τρυπτοφάνη trp (W) 204 ταξινομείται επίσης ως αρωματικό αμινοξύ
μεθειονίνη γνώρισα (Μ) 149 Η πλευρική αλυσίδα λειτουργεί ως δότης ομάδας μεθυλίου
προλίνη επαγγελματίας (P) 115 περιέχει μια ομάδα δευτεροταγούς αμίνης που αναφέρεται ως α &άλφα-ιμινο οξύ
Αμινοξέα με πολική αλλά ουδέτερη ομάδα R
σερίνη ser (S) 105 βρίσκεται στο ενεργό κέντρο πολλών ενζύμων
θρεονίνη thr (T) 119 που πήρε το όνομά του για την ομοιότητά του με τη σακχαρόζη
κυστεΐνη cys (C) 121 η οξείδωση δύο μορίων κυστεΐνης αποδίδει κυστίνη
τυροσίνη Tyr (Y) 181 ταξινομείται επίσης ως αρωματικό αμινοξύ
ασπαραγίνη asn (N) 132 το αμίδιο του ασπαρτικού οξέος
γλουταμίνη gln (Q) 146 το αμίδιο του γλουταμινικού οξέος
Αμινοξέα με αρνητικά φορτισμένη ομάδα R
ασπαρτικό οξύ asp (D) 132 Οι καρβοξυλικές ομάδες ιονίζονται σε φυσιολογικό pH γνωστό και ως ασπαρτικό
γλουταμινικό οξύ glu (E) 146 Οι καρβοξυλικές ομάδες ιονίζονται σε φυσιολογικό pH γνωστό και ως γλουταμινικό
Αμινοξέα με θετικά φορτισμένη ομάδα R
ιστιδίνη του (Η) 155 το μόνο αμινοξύ του οποίου η ομάδα R έχει pKένα (6.0) κοντά στο φυσιολογικό pH
λυσίνη lys (K) 147 &mdash
αργινίνη arg (R) 175 σχεδόν τόσο ισχυρή βάση όσο το υδροξείδιο του νατρίου

Το πρώτο αμινοξύ που απομονώθηκε ήταν η ασπαραγίνη το 1806. Λήφθηκε από πρωτεΐνη που βρέθηκε στο χυμό των σπαραγγιών (εξ ου και το όνομα). Η γλυκίνη, το κύριο αμινοξύ που βρίσκεται στη ζελατίνη, ονομάστηκε για τη γλυκιά γεύση της (ελληνικά γλύκυς, που σημαίνει &ldquosweet&rdquo). Σε ορισμένες περιπτώσεις, ένα αμινοξύ που βρίσκεται σε μια πρωτεΐνη είναι στην πραγματικότητα παράγωγο ενός από τα κοινά 20 αμινοξέα (ένα τέτοιο παράγωγο είναι η υδροξυπρολίνη). Η τροποποίηση γίνεται μετά το αμινοξύ έχει συναρμολογηθεί σε μια πρωτεΐνη.


Καταγγελία DMCA

Εάν πιστεύετε ότι το περιεχόμενο που διατίθεται μέσω της Ιστοσελίδας (όπως ορίζεται στους Όρους Παροχής Υπηρεσιών) παραβιάζει ένα ή περισσότερα από τα πνευματικά σας δικαιώματα, ενημερώστε μας παρέχοντας μια γραπτή ειδοποίηση («Ειδοποίηση παραβίασης») που περιέχει τις πληροφορίες που περιγράφονται παρακάτω στους καθορισμένους αντιπρόσωπος που αναφέρεται παρακάτω. Εάν το Varsity Tutors λάβει μέτρα ως απάντηση σε μια Ειδοποίηση παραβίασης, θα προσπαθήσει καλή τη πίστει να επικοινωνήσει με το μέρος που έκανε αυτό το περιεχόμενο διαθέσιμο μέσω της πιο πρόσφατης διεύθυνσης ηλεκτρονικού ταχυδρομείου, εάν υπάρχει, που παρέχεται από αυτό το μέρος στο Varsity Tutors.

Η Ειδοποίηση παραβίασης ενδέχεται να προωθηθεί στο μέρος που έκανε το περιεχόμενο διαθέσιμο ή σε τρίτα μέρη όπως το ChillingEffects.org.

Λάβετε υπόψη ότι θα είστε υπεύθυνοι για ζημιές (συμπεριλαμβανομένων των εξόδων και των αμοιβών δικηγόρων) εάν παραποιήσετε ουσιωδώς ότι ένα προϊόν ή μια δραστηριότητα παραβιάζει τα πνευματικά σας δικαιώματα. Επομένως, εάν δεν είστε βέβαιοι ότι το περιεχόμενο που βρίσκεται ή συνδέεται με τον Ιστότοπο παραβιάζει τα πνευματικά σας δικαιώματα, θα πρέπει πρώτα να εξετάσετε το ενδεχόμενο να επικοινωνήσετε με έναν δικηγόρο.

Ακολουθήστε αυτά τα βήματα για να υποβάλετε μια ειδοποίηση:

Πρέπει να συμπεριλάβετε τα ακόλουθα:

Μια φυσική ή ηλεκτρονική υπογραφή του κατόχου των πνευματικών δικαιωμάτων ή ενός ατόμου που είναι εξουσιοδοτημένο να ενεργεί για λογαριασμό του Ταυτοποίηση των πνευματικών δικαιωμάτων που ισχυρίζονται ότι έχουν παραβιαστεί Περιγραφή της φύσης και της ακριβούς τοποθεσίας του περιεχομένου που ισχυρίζεστε ότι παραβιάζει τα πνευματικά σας δικαιώματα, επαρκώς λεπτομέρεια που θα επιτρέψει στους καθηγητές του Varsity να βρουν και να προσδιορίσουν θετικά αυτό το περιεχόμενο, για παράδειγμα, χρειαζόμαστε έναν σύνδεσμο προς τη συγκεκριμένη ερώτηση (όχι μόνο το όνομα της ερώτησης) που περιέχει το περιεχόμενο και μια περιγραφή του συγκεκριμένου τμήματος της ερώτησης - μια εικόνα, μια σύνδεσμος, το κείμενο κ.λπ. – το παράπονό σας αναφέρεται στο όνομα, τη διεύθυνση, τον αριθμό τηλεφώνου και τη διεύθυνση ηλεκτρονικού ταχυδρομείου σας και μια δήλωσή σας: (α) ότι πιστεύετε καλή τη πίστη ότι η χρήση του περιεχομένου που ισχυρίζεστε ότι παραβιάζει τα πνευματικά σας δικαιώματα είναι δεν είναι εξουσιοδοτημένο από το νόμο ή από τον κάτοχο των πνευματικών δικαιωμάτων ή τον αντιπρόσωπο αυτού του κατόχου (β) ότι όλες οι πληροφορίες που περιέχονται στη Σημείωση περί παραβίασης είναι ακριβείς και (γ) με την ποινή της ψευδορκίας, ότι είστε είτε ο κάτοχος των πνευματικών δικαιωμάτων ή ένα άτομο εξουσιοδοτημένο να ενεργεί για λογαριασμό του.

Στείλτε το παράπονό σας στον καθορισμένο αντιπρόσωπό μας στη διεύθυνση:

Charles Cohn Varsity Tutors LLC
101 S. Hanley Rd, Suite 300
Σεντ Λούις, MO 63105


Μέθοδοι

Υλικά

Τα σημασμένα με 3 Η αμινοξέα ήταν από την Amersham. Η αμπικιλλίνη, G418, υγρομυκίνη Β, φλεομυκίνη, Μ-199 (μέσο-199) και μη επισημασμένα L-αμινοξέα ήταν από τη Sigma. Ο εμβρυϊκός βόειος ορός (FBS) ήταν από την Biological Industries. Όλα τα άλλα αντιδραστήρια ήταν αναλυτικής ποιότητας.

Καλλιέργεια κυττάρων Leishmania

Μια κλωνική γραμμή του L. donovani Σε όλα τα πειράματα χρησιμοποιήθηκε 1SR 25 . Για να εξασφαλιστεί η κλωνική φύση της κυτταρικής σειράς, φρέσκες καλλιέργειες εμβολιάστηκαν χρησιμοποιώντας μεμονωμένες αποικίες προμαστιγωτών που ελήφθησαν από τρυβλία άγαρ Μ-199. Οι προμαστιγώτες αναπτύχθηκαν στους 26 ଌ σε M-199 συμπληρωμένο με 10% FBS.

Ανάλυση Western blot

Η ανάλυση στυπώματος Western διεξήχθη όπως περιγράφηκε προηγουμένως 9. Εν συντομία, συλλέχθηκαν 10 8 κύτταρα προμαστιγώτων λογαριθμικής φάσης, πλύθηκαν δύο φορές σε παγωμένο αλατούχο φωσφορικό ρυθμιστικό διάλυμα (PBS) και φυγοκεντρήθηκαν εκ νέου. Το προκύπτον σφαιρίδιο επαναιωρήθηκε σε ρυθμιστικό διάλυμα Laemmli και στη συνέχεια υποβλήθηκε σε υπερήχους για 2 s για να εξασφαλιστεί η μετουσίωση. Η παρασκευή των μεμβρανών που εκχυλίζονται από άλας διεξήχθη όπως περιγράφεται στο 26. Η ολική πρωτεΐνη υποβλήθηκε σε SDS/PAGE (mini-PROTEAN Bio-Rad Laboratories) πριν μεταφερθεί σε μεμβράνη νιτροκυτταρίνης. Οι μεμβράνες αποκλείστηκαν με 10% (w/v) άπαχο αποξηραμένο αποβουτυρωμένο γάλα σε σκόνη σε PBST (PBS που περιέχει 0,1% Tween 20), επωάστηκαν με αντισώματα anti-LdAAP24 ή αντι-ΗΑ (αραίωση 1:2000) για 1 h σε θερμοκρασία δωματίου (22 ଌ), πλύθηκε και στη συνέχεια επωάστηκε με δευτερεύοντα αντισώματα κατσίκας κατά HRP (υπεροξειδάση χρένου) κατά του κουνελιού (αραίωση 1:10000).

Αναλύσεις ανοσοφθορισμού

Για τον ανοσοφθορισμό, οι προμαστιγώτες mid-log πλύθηκαν δύο φορές σε PBS και στη συνέχεια σταθεροποιήθηκαν σε 1% φορμαλδεΰδη/PBS σε αντικειμενοφόρο πλάκα για 10  λεπτά πριν από τη διαπερατότητα με έκθεση σε 0,2% Triton X-100/PBS για 10 λεπτά Τα κύτταρα επωάστηκαν με δεσμευτικό διάλυμα [10% (v/v) άπαχο αποξηραμένο αποβουτυρωμένο γάλα σε σκόνη/PBST] για 30  λεπτά σε θερμοκρασία δωματίου, επωάστηκαν με αντισώματα αντι-LdAAP24 ή αντι-ΗΑ (αραίωση 1:200) για 1 και #x02009h και στη συνέχεια επωάστηκε με δευτερεύοντα πολυκλωνικά φθορίζοντα αντισώματα κατσίκας αντι-κουνελιού IgG (αραίωση 1:500 Dy-light 549 Red Jackson) για 1  ώρα στο σκοτάδι σε θερμοκρασία δωματίου. Τέλος, τα κύτταρα πλύθηκαν σε PBST και συμπληρώθηκαν με 5 μl DAPI (4′,6-διαμιδινο-2-φαινυλινδόλη 0,5 μg/ml Fluka). Πραγματοποιήθηκαν αναλύσεις φθορισμού χρησιμοποιώντας ομοεστιακό μικροσκόπιο φθορισμού (Axiovert 200M Zeiss).

Κλωνοποίηση και έκφραση

Ενισχυμένο με PCR LdAAP24 (ανοικτά πλαίσια ανάγνωσης (ORF) LinJ10.0760 και LinJ10.0770), καθώς και περικομμένες εκδόσεις των ORF του μεταφορέα’s κλωνοποιήθηκαν σε Leishmania φορείς έκφρασης pNUS-HnB 27 μεταξύ των θέσεων XhoI και KpnI. Το διαλυτό Ν-άκρο κλωνοποιήθηκε σε pNUS-HnD 27 μεταξύ των θέσεων XhoI και KpnI. Όλες οι κατασκευές εκτός από το 𹐘LdAAP24 επισημάνθηκαν με μια ετικέτα ΗΑ στο C-άκρο. Για να βεβαιωθούμε ότι η αναμενόμενη τοπολογία κάθε κατασκευής δεν επηρεάστηκε, χρησιμοποιούμε το TMHMM 2.0 (http://www.cbs.dtu.dk/services/TMHMM/) 28 . Οι εκκινητές για όλες τις κατασκευές εμφανίζονται στον Πίνακα S1. Για επιλογή, τα κύτταρα αναπτύχθηκαν σε μέσο προμαστιγωτών που περιείχε αντιβιοτικά είτε φλεομυκίνης είτε βλαστικτίνης. Η επιτυχής έκφραση επικυρώθηκε με ανάλυση στυπώματος western.

RNA-αλληλουχία

Οι βιβλιοθήκες RNA-seq παρασκευάστηκαν χρησιμοποιώντας δύο μεθόδους. Οι βιβλιοθήκες Splice Leader (SL) RNA-seq, οι οποίες εμπλουτίζουν το 5′ άκρο των mRNAs, παρασκευάστηκαν όπως περιγράφεται αλλού (http://www.ncbi.nlm.nih.gov/pubmed/?term=23382545). Οι βιβλιοθήκες PolyA RNA-seq, οι οποίες είναι εμπλουτισμένες για το άκρο 3′ των mRNAs, παρασκευάστηκαν με παρόμοιο τρόπο, αναμένεται ότι ένας εκκινητής ολιγο(dT) (TCCGATCTCTTTTTTTTV) χρησιμοποιήθηκε για τη σύνθεση του πρώτου κλώνου, ένας τυχαίος εκκινητής εξαμερούς (TCCGATCTGANNNNNNN) για τη σύνθεση του δεύτερου κλώνου και η ενίσχυση PCR πραγματοποιήθηκε χρησιμοποιώντας seq-primer-CT (AATGATACGGCGACCACCGACACTCTTTTTCCCTACACGACGCTCTTCGATCTCT) και R-primer-GA (CAAGCAGAAGACGGCATACGAGCTCTTCGATCTGA). Η αλληλουχία των βιβλιοθηκών έγινε με τη χρήση του Genome Analyzer IIx (Illumina) στη Μονάδα Γονιδιωματικής Υψηλής Απόδοσης στο Πανεπιστήμιο της Ουάσιγκτον για τη δημιουργία αναγνώσεων ενός άκρου μήκους 36 nt. Οι αναγνώσεις ευθυγραμμίστηκαν με το L. donovani BPK282A1 και L. infantum Γονιδιώματα αναφοράς JPCM5 στο TriTrypDBv5.0 χρησιμοποιώντας Bowtie2 29 .

Αναλύσεις μεταφοράς

Δοκιμασίες μεταφοράς ραδιοσημασμένης προλίνης και αλανίνης πραγματοποιήθηκαν όπως περιγράφεται στο 8. L. donovani Οι προμαστιγώτες αναπτύχθηκαν σε λογαριθμική φάση, πλύθηκαν δύο φορές σε παγωμένο ρυθμιστικό διάλυμα Earl’s και συμπυκνώθηκαν στα 108 κύτταρα/ml. Το κυτταρικό εναιώρημα αναμίχθηκε με μίγμα αντίδρασης (ρυθμιστικό διάλυμα Earl’s, 5 mM γλυκόζη, 10 mM Tris και 10 mM ηλεκτρικό) στο σχετικό pH σε τελικό όγκο 6200&#x. Τα κύτταρα στη συνέχεια προεπωάστηκαν στους 30 ଌ για 10  λεπτά. Η μεταφορά ξεκίνησε με ανάμιξη του κυτταρικού εναιωρήματος με μια καθορισμένη συγκέντρωση μη σημασμένων αμινοξέων και υποστρωμάτων 3H L-αμινοξέων σε ρυθμιστικό διάλυμα Earl’s στο σχετικό pH. Στα 30, 60, 90, 120 και 180 δευτερόλεπτα, αφαιρέθηκαν 100 μl του μείγματος και τοποθετήθηκαν απευθείας σε φίλτρα μικροϊνών από γυαλί 24 mm GF/C (Whatman 1822 024). Τα φίλτρα πλύθηκαν δύο φορές σε παγωμένο ρυθμιστικό διάλυμα Earl’s στο σχετικό pH και εμποτίστηκαν σε υγρό σπινθηρισμού. Η πρόσληψη 3 Η προσδιορίστηκε με μέτρηση υγρού σπινθηρισμού.


Χειρικότητα

Όλα τα αμινοξέα εκτός από τη γλυκίνη είναι χειρόμορφα μόρια. Δηλαδή, υπάρχουν σε δύο οπτικά ενεργές ασύμμετρες μορφές (που ονομάζονται εναντιομερή) που είναι οι κατοπτρικές εικόνες η μία της άλλης. (Αυτή η ιδιότητα είναι εννοιολογικά παρόμοια με τη χωρική σχέση του αριστερού χεριού με το δεξί χέρι.) Το ένα εναντιομερές ορίζεται ως d και το άλλο l . Είναι σημαντικό να σημειωθεί ότι τα αμινοξέα που βρίσκονται στις πρωτεΐνες έχουν σχεδόν πάντα μόνο την l-διάταξη. Αυτό αντανακλά το γεγονός ότι τα ένζυμα που είναι υπεύθυνα για τη σύνθεση πρωτεϊνών έχουν εξελιχθεί για να χρησιμοποιούν μόνο τα 1-εναντιομερή. Αντικατοπτρίζοντας αυτή τη σχεδόν καθολικότητα, το πρόθεμα l συνήθως παραλείπεται. Ορισμένα d-αμινοξέα βρίσκονται σε μικροοργανισμούς, ιδιαίτερα στα κυτταρικά τοιχώματα των βακτηρίων και σε αρκετά από τα αντιβιοτικά. Ωστόσο, αυτά δεν συντίθενται στο ριβόσωμα.


Περιεχόμενα

Όλα τα αμινοξέα έχουν ένα καρβοξυλικό άκρο (που ονομάζεται C-άκρο) και ένα αμινοτελικό άκρο (που ονομάζεται Ν-άκρο), αλλά διαφέρουν ως προς τις υπολειμματικές τους ομάδες. Τα αμινοξέα συνδέονται μεταξύ τους με έναν ομοιοπολικό δεσμό που ονομάζεται πεπτιδικός δεσμός [6] . Τα αμινοξέα περιέχουν τόσο μια καρβοξυλομάδα (COOH) όσο και μια αμινομάδα (ΝΗ2). Η δομή του πυρήνα των αμινοξέων είναι:

Όπου (R) είναι η πλευρική αλυσίδα μοναδική για κάθε διαφορετικό αμινοξύ. Μεγάλα αμινοξέα σχηματίζουν την άκαμπτη περιοχή της ραχοκοκαλιάς του πολυπεπτιδίου ενώ τα μικρά αμινοξέα σχηματίζουν τις εύκαμπτες περιοχές του πολυπεπτιδίου επιτρέποντας στην πρωτεΐνη να διπλωθεί στο τρισδιάστατο σχήμα της. Στη ραχοκοκαλιά του πεπτιδίου υπάρχει ευέλικτη περιστροφή γύρω από τον πεπτιδικό δεσμό και υπάρχει ένα άκαμπτο επίπεδο πεπτίδιο που προκαλείται από έναν μερικό διπλό δεσμό. Αυτό είναι που επιτρέπει στην πρωτογενή αλληλουχία των πολυπεπτιδίων να αναδιπλωθούν σε μια άλφα έλικα η οποία είναι κουλουριασμένη με έναν κλώνο. Ένας βήτα κλώνος είναι δύο κλώνοι κουλουριασμένοι σε μια αντιπαράλληλη έλικα. Ο πυρήνας του πολυπεπτιδίου αποτελείται από τα υδρόφοβα αμινοξέα όπως η φαιναλανίνη, η τυροσίνη και η τρυπτοφάνη [8] . Αυτά τα τρία αμινοξέα είναι επίσης αρωματικά και είναι τα μεγαλύτερα αμινοξέα. Τα άλλα υδρόφοβα αμινοξέα, αλλά δεν είναι αρωματικά, είναι: προλίνη, βαλίνη, ισολευκίνη, λευκίνη και μεθειονίνη.

Τα αμινοξέα αναφέρονται ως χειρόμορφα λόγω του ότι ο άλφα άνθρακας συνδέεται με τέσσερις διαφορετικές ομάδες. Μπορούν να υπάρχουν ως μία από τις δύο κατοπτρικές εικόνες που αναφέρονται ως το αριστερόστροφο ισομερές L και το δεξτροστροφικό ισομερές D με μόνο τη μορφή L του ισομερούς αμινοξέος να υπάρχει στις πρωτεΐνες [9] .

Τα αμινοξέα σε διάλυμα σε ουδέτερο pH υπάρχουν κυρίως ως διπολικά ιόντα ή διπολικά ιόντα. Στη διπολική μορφή, η αμινομάδα πρωτονιώνεται και η καρβοξυλική ομάδα αποπρωτονιώνεται. Η κατάσταση ιονισμού ενός αμινοξέος ποικίλλει ανάλογα με το pH [10] . Μια σειρά αμινοξέων που ενώνονται με πεπτιδικούς δεσμούς σχηματίζουν μια πολυπεπτιδική αλυσίδα και κάθε μονάδα αμινοξέος σε ένα πεπτίδιο ονομάζεται υπόλειμμα. Δύο αμινοξέα μπορούν να υποστούν μια αντίδραση συμπύκνωσης για να σχηματίσουν ένα διπεπτίδιο, που συνοδεύεται από απώλεια μορίου νερού [11] .

Τα κοινά αμινοξέα ομαδοποιούνται σύμφωνα με τις πλευρικές τους αλυσίδες [12] . Για παράδειγμα, όξινο, βασικό, μη φορτισμένο πολικό και μη πολικό.

Για τις βασικές πλευρικές αλυσίδες, τα αμινοξέα είναι: Λυσίνη (Κ), Αργινίνη (R) και Ιστιδίνη (Η).

Για τις όξινες πλευρικές αλυσίδες, τα αμινοξέα είναι: Ασπαρτικό οξύ (D) και Γλουταμινικό οξύ (Ε) (που σχηματίζεται με την προσθήκη ενός πρωτονίου στα αμινοξέα ασπαρτικό και γλουταμινικό).

Για τις μη φορτισμένες πολικές πλευρικές αλυσίδες, τα αμινοξέα είναι: Ασπαραγίνη (Ν), Γλουταμίνη (Q), Σερίνη (S), Θρεονίνη (Τ) και Τυροσίνη (Υ).

Προλίνη (P)

Η προλίνη είναι επίσης γνωστή ως αμινοξύ. που βρίσκεται συνήθως σε ζωικές πρωτεΐνες. Δεν είναι απαραίτητο για την ανθρώπινη διατροφή, καθώς μπορεί να συντεθεί στον οργανισμό από γλουταμινικό οξύ [13] . Σε αντίθεση με άλλα αμινοξέα που υπάρχουν στον μετασχηματισμό σε πολυπεπτίδια, η προλίνη μπορεί να υπάρχει στη μορφή cis στα πεπτίδια. Η προλίνη βρίσκεται συχνά στο τέλος της α έλικας ή σε στροφές ή βρόχους [14] . Η προλίνη είναι το μόνο κυκλικό αμινοξύ. Αυτό οφείλεται στο ότι η προλίνη έχει μια περίεργη, κυκλική δομή όταν σχηματίζει πεπτιδικούς δεσμούς, προκαλεί μια κάμψη στην αλυσίδα αμινοξέων. Ως εκ τούτου, η προλίνη είναι επίσης γνωστή ως διακόπτης άλφα έλικας (ο άλλος διακόπτης άλφα έλικας είναι η Γλυκίνη) [15] .

Αμινοξέα στη Μετάφραση

Κατά τη μετάφραση του mRNA, τα αμινοξέα συνδέονται με το ριβόσωμα καθώς αυτό διαβάζει το mRNA και χρησιμοποιώντας τις πληροφορίες που δίνονται παράγει μια συγκεκριμένη αλληλουχία αμινοξέων σχηματίζοντας πεπτιδικούς δεσμούς μεταξύ της καρβοξυλικής ομάδας ενός αμινοξέος και της αμινομάδας ενός άλλου μέσω συμπύκνωσης αντίδραση. Αυτό παράγει μια πολυπεπτιδική αλυσίδα. Η υπομονάδα 30S συνδέεται πρώτα με το mRNA και η υπομονάδα 50S δεσμεύεται δεύτερη για να σχηματίσει το σύμπλεγμα εκκινητή 70S [16] .

Κυστεΐνη (C)

Το αμινοξύ Κυστεΐνη έχει πολλές εφαρμογές και παίζει σημαντικό ρόλο στη δομή των πρωτεϊνών. Αυτό οφείλεται κυρίως στην ομάδα θειόλης του. Η θειόλη (που αποτελείται από ένα άτομο θείου και υδρογόνου) είναι πολύ ευαίσθητη στην οξείδωση, επιτρέποντας στην κυστεΐνη να σχηματίσει δισουλφιδικούς δεσμούς με άλλα μόρια, συμπεριλαμβανομένων άλλων κυστεϊνών. Το προκύπτον προϊόν δύο συνδεδεμένων κυστεϊνών ονομάζεται κυστίνη. Όταν συνδέεται με άλλες κυστεΐνες, ο δισουλφιδικός δεσμός αυξάνει σημαντικά τη σταθερότητα της πρωτεΐνης. Ωστόσο, καθώς πρόκειται για αντίδραση οξείδωσης, είναι αποκλειστική για εξωκυτταρικές πρωτεΐνες με λίγες εξαιρέσεις. Αυτό συμβαίνει επειδή το εσωτερικό του κυττάρου μειώνεται σε μεγάλο βαθμό, καθιστώντας τον δισουλφιδικό δεσμό εξαιρετικά ασταθή.

Αρωματικά αμινοξέα

Τα αρωματικά αμινοξέα είναι τα μεγαλύτερα από τα αμινοξέα και περιλαμβάνουν φαινυλαλανίνη (F), τυροσίνη (Y) και τρυπτοφάνη (W). Μπορούν όλα να απορροφήσουν το υπεριώδες φως, ωστόσο μερικά μπορούν να απορροφήσουν περισσότερο από άλλα, η τυροσίνη και η τρυπτοφάνη απορροφούν περισσότερο από τη φαινυλαλανίνη που σημαίνει ότι η τρυπτοφάνη είναι το κύριο μόριο που απορροφά το φως στην πρωτεΐνη. Τα αρωματικά αμινοξέα είναι επίσης υδρόφοβα, επομένως βρίσκονται στον πυρήνα της πρωτεΐνης διασφαλίζοντας ότι δεν βρίσκονται κοντά στο νερό. Οι άνθρωποι δεν μπορούν να συνθέσουν φαινυλαλανίνη ή τρυπτοφάνη και μπορούν να κάνουν μόνο τυροσίνη από φαινυλαλανίνη, αυτό σημαίνει ότι τα αρωματικά αμινοξέα είναι ζωτικό συστατικό της διατροφής μας καθώς τα χρειαζόμαστε σε ορισμένες πρωτεΐνες αλλά δεν τα συνθέτουμε μόνοι μας. Τα αρωματικά αμινοξέα περιέχουν έναν αρωματικό δακτύλιο [17] . Η ανεπάρκεια φαινυλαλανίνης μπορεί να προκαλέσει σύγχυση, κατάθλιψη, έλλειψη ενέργειας και μειωμένη εγρήγορση. Μπορεί να αγοραστεί σε μορφή δισκίου για να συμπληρώσει οποιαδήποτε ανεπάρκεια [18] . Η αδυναμία διάσπασης της περίσσειας φαινυλαλανίνης ονομάζεται φαινυλκετονουρία. Για να καταπολεμηθεί αυτό, χρησιμοποιείται μια δίαιτα χαμηλή σε φαινυλαλανίνη και αποφεύγονται οι γλυκαντικές ουσίες ασπαρτάμης που μοιάζουν με φαινυλαλανίνη και μπορούν να διασπαστούν για να την παράγουν.


Ομάδα II: Πολικά, αφόρτιστα αμινοξέα

Τα αμινοξέα της ομάδας II είναι η σερίνη, η κυστεΐνη, η θρεονίνη, η τυροσίνη, η ασπαραγίνη και η γλουταμίνη. Οι πλευρικές αλυσίδες σε αυτή την ομάδα διαθέτουν ένα φάσμα λειτουργικών ομάδων. Ωστόσο, τα περισσότερα έχουν τουλάχιστον ένα άτομο (άζωτο, οξυγόνο ή θείο) με ζεύγη ηλεκτρονίων διαθέσιμα για δεσμούς υδρογόνου με το νερό και άλλα μόρια. Οι χημικές δομές των αμινοξέων της Ομάδας II είναι:

Δύο αμινοξέα, η σερίνη και η θρεονίνη, περιέχουν αλειφατικές υδροξυλομάδες (δηλαδή, ένα άτομο οξυγόνου συνδεδεμένο με ένα άτομο υδρογόνου, που αντιπροσωπεύεται ως -ΟΗ). Η τυροσίνη διαθέτει μια ομάδα υδροξυλίου στον αρωματικό δακτύλιο, καθιστώντας την ένα παράγωγο φαινόλης. Οι ομάδες υδροξυλίου σε αυτά τα τρία αμινοξέα υπόκεινται σε έναν σημαντικό τύπο μεταμεταφραστικής τροποποίησης: φωσφορυλίωση (Δες παρακάτω Μη τυπικά αμινοξέα). Όπως η μεθειονίνη, η κυστεΐνη περιέχει ένα άτομο θείου. Σε αντίθεση με το άτομο θείου της μεθειονίνης, ωστόσο, το θείο της κυστεΐνης είναι πολύ χημικά αντιδραστικό (Δες παρακάτω οξείδωση κυστεΐνης). Η ασπαραγίνη, που απομονώθηκε αρχικά από τα σπαράγγια, και η γλουταμίνη περιέχουν αμφότερα αμίδιο R ομάδες. Η καρβονυλική ομάδα μπορεί να λειτουργήσει ως δέκτης δεσμού υδρογόνου και η αμινομάδα (ΝΗ2) μπορεί να λειτουργήσει ως δότης δεσμού υδρογόνου.


Διπλώματα και Αμινοξέα

Ένα αμφιτεριόν είναι ένα μόριο με λειτουργικές ομάδες, από τις οποίες τουλάχιστον μία έχει θετικό και μία αρνητικό ηλεκτρικό φορτίο. Το καθαρό φορτίο ολόκληρου του μορίου είναι μηδέν.

Τα αμινοξέα είναι τα πιο γνωστά παραδείγματα αμφιτεριόντων. Περιέχουν μια ομάδα αμίνης (βασική) και μια καρβοξυλική ομάδα (όξινη). Το -NH2 η ομάδα είναι η ισχυρότερη βάση, και έτσι παίρνει το H + από την ομάδα -COOH για να αφήσει ένα αμφιτεριόν (δηλαδή η ομάδα αμίνης αποπρωτονιώνει το καρβοξυλικό οξύ): 1

Το (ουδέτερο) αμφιτεριόν είναι η συνήθης μορφή αμινοξέων που υπάρχουν σε διάλυμα. Ανάλογα με το pH, υπάρχουν δύο άλλες μορφές, ένα ανιόν και ένα κατιόν:

Αυτό είναι παράλληλο με τη συμπεριφορά ενός διπρωτικού οξέος:

με δύο στάδια διάστασης που ελέγχονται από δύο σταθερές οξύτητας Κ1 και Κ2.

Όταν ένα αμινοξύ διαλύεται στο νερό, το αμφιτεριόν αλληλεπιδρά με το Η2Μόρια O – λειτουργούν και ως οξύ και ως βάση. Αλλά, σε αντίθεση με το απλό αμφοτερικός ενώσεις που μπορούν να σχηματίσουν μόνο ένα κατιονικό ή ανιονικό είδος, ένα αμφιτεριόν έχει ταυτόχρονα και τις δύο ιοντικές καταστάσεις.

Το απλούστερο αμινοξύ είναι η γλυκίνη (NH2-Χ.Θ2-COOH), το οποίο συντομεύουμε με HGly, ή συντομότερο με HA με A = Gly-. Ο δομικός τύπος του που φαίνεται παραπάνω έχει τη μικρότερη πλευρική αλυσίδα R = H. Τα τρία είδη είναι:

[0] = [Η2A + ] = [Η2Gly + ] : NH3 + -CH2-COOH (γλυκίνιο κατιόν)
[1] = [HA] = [HGly] : NH3 + -CH2-COO - (ουδέτερος διπολικό)
[2] = [A - ] = [Gly - ] : NH2-Χ.Θ2-COO - (γλυκινικό ανιόν)

Οι δύο σταθερές οξύτητας (σε σύγκριση με το ανθρακικό οξύ) είναι:

γλυκίνη: pK1 = 2.35 pK2 = 9.78
ανθρακικό οξύ: pK1 = 6.35 pK2 = 11.33

Η εξάρτηση από το pH των τριών ειδών (συντομογραφία με [j]=[0], [1], [2]) εμφανίζεται με τη μορφή των αντίστοιχων κλασμάτων ιονισμού aι = [j]/CΤ:

Καμπύλες ογκομέτρησης. Οι καμπύλες τιτλοδότησης εμφανίζουν τι συμβαίνει γλυκίνη καθώς αλλάζετε το pH προσθέτοντας είτε ένα ισχυρό οξύ (HCl) είτε μια ισχυρή βάση (NaOH):

Στο αριστερό διάγραμμα, τέσσερα ποσά ΓΤ της γλυκίνης λαμβάνονται υπόψη. Οι υπολογισμοί γίνονται με τους αναλυτικούς τύπους που παρουσιάζονται εδώ ή σε pdf. Οι τελείες στο δεξιό διάγραμμα είναι αριθμητικοί υπολογισμοί με aqion.

Χωρητικότητα buffer και ένταση buffer

Η μαθηματική περιγραφή των χωρητικοτήτων και των εντάσεων του ρυθμιστικού διαλύματος είναι η ίδια όπως για τα κοινά οξέα (εκτός από τη μετατόπιση Z=1). Τα παρακάτω διαγράμματα δείχνουν την χωρητικότητα του ρυθμιστικού διαλύματος (μπλε καμπύλη τιτλοδότησης) μαζί με την αντίστοιχη ένταση του ρυθμιστικού διαλύματος β (πράσινο) και το παράγωγό του dβ/dpH (κόκκινο). Αυτό γίνεται για δύο περιπτώσεις: απείρως υψηλή συγκέντρωση γλυκίνης και για CΤ = 500 mM.

Οι μικρές κουκκίδες είναι τα μηδενικά του dβ/dpH, τα οποία υποδεικνύουν τα άκρα της έντασης του ρυθμιστικού διαλύματος β και σημειώνουν τα σημεία καμπής των καμπυλών ογκομέτρησης. Η μπλε καμπύλη ογκομέτρησης στο προηγούμενο αριστερό διάγραμμα είναι ίδια με αυτή του τελευταίου διαγράμματος, εκτός από το ότι οι άξονες x και y ανταλλάσσονται.

Περισσότερα παραδείγματα για αμφιτεριονικά οξέα δίνονται εδώ.

Το R υποδηλώνει την πλευρική αλυσίδα (γλυκίνη: R = H, αλανίνη: R = CH3, και ούτω καθεξής). ↩


Αμινοξέα: Έννοια, Ταξινόμηση και Αντιδράσεις

Τα αμινοξέα είναι τα δομικά στοιχεία των πρωτεϊνών. Μεταξύ των χιλιάδων αμινοξέων που είναι διαθέσιμα στη φύση, οι πρωτεΐνες περιέχουν μόνο 20 διαφορετικά είδη αμινοξέων, όλα τους είναι L-άλφα-αμινοξέα. Τα ίδια 20 τυπικά αμινοξέα παράγουν πρωτεΐνες σε όλα τα ζωντανά κύτταρα, μπορεί να είναι ιός, βακτήριο, ζυμομύκητα, φυτικό ή ανθρώπινο κύτταρο. Αυτά τα 20 αμινοξέα συνδυάζονται σε διαφορετικές αλληλουχίες και αριθμούς για να σχηματίσουν διάφορα είδη πρωτεϊνών.

Ο αριθμός των πρωτεϊνών που μπορούν να ληφθούν από αυτά τα 20 αμινοξέα μπορεί να υπολογιστεί από 20 παραγοντικές, δηλαδή, 20 x 19 x 18 x 17 x 16 x ………… x 2 x 1 = 2,4 x 10 18 . Μόνο στον άνθρωπο υπάρχουν περισσότεροι από 100.000 διαφορετικοί τύποι πρωτεϊνών.

Οι γενικοί τύποι για ένα αμινοξύ μπορούν να γραφτούν ως ‘R-CH-NH2—COOH’. Ανάλογα με την ομάδα ‘R’ που υπάρχει στο αμινοξύ ονομάζεται ανάλογα. Τα 20 αμινοξέα που βρίσκονται στις πρωτεΐνες είναι γνωστά ως πρωτογενή ή τυπικά αμινοξέα. Εκτός από αυτά, ορισμένα άλλα αμινοξέα βρίσκονται επίσης σε πρωτεΐνες όπως η 4-υδροξυπρολίνη, η 5-υδροξυλυσίνη, η 6-IV-μεθυλλυσίνη, το γάμμα καρβοξυγλουταμινικό οξύ και η δεσμοσίνη, όλα αυτά είναι παράγωγα τυπικών αμινοξέων.

Ταξινόμηση αμινοξέων:

I. Ανάλογα με τη χρέωση:

Τα αμινοξέα μπορούν να ταξινομηθούν ευρέως σε τρεις μεγάλες ομάδες:

1. Ουδέτερα αμινοξέα:

Αυτά τα αμινοξέα που δεν περιέχουν κανένα φορτίο στην ομάδα ‘R’.

Περαιτέρω ταξινομούνται στις ακόλουθες κατηγορίες:

Αυτά τα αμινοξέα των οποίων η ομάδα ‘R’ περιέχει μια αλυσίδα ατόμων άνθρακα—Gly, Ala, Ser, Thr, Val, Leu, lie, Asn, Gin.

Αυτά τα αμινοξέα των οποίων η ομάδα ‘R’ έχει δακτύλιο βενζολίου—Phe, Tyr, Trp.

Η ομάδα “R” έχει έναν ετεροκυκλικό δακτύλιο, δηλ. οποιαδήποτε από τις δομές δακτυλίου που περιέχει διαφορετικά άτομα—Pro, His.

(ρε) Θείο που περιέχει:

Εκείνα τα αμινοξέα που περιέχουν ένα άτομο θείου-Cys, Met.

Αυτά τα αμινοξέα που περιέχουν αρνητικό φορτίο ή όξινη ομάδα-Asp, Glu.

Αυτά τα αμινοξέα που περιέχουν θετικό φορτίο ή μια βασική ομάδα-Arg, Lys και His.

II. Ανάλογα με τη διαλυτότητα στο νερό:

Τα αμινοξέα μπορούν επίσης να ομαδοποιηθούν σε δύο διαφορετικές κατηγορίες, ανάλογα με τη διαλυτότητά τους στο νερό. Αυτοί είναι-

1. Υδρόφοβα αμινοξέα:

Τα αμινοξέα που είναι αδιάλυτα στο νερό είναι γνωστά ως υδρόφοβα αμινοξέα. Είναι—Ala, Val, Leu, lie, Pro, Met, Phe, Trp.

2. Υδρόφιλα αμινοξέα:

Τα αμινοξέα που είναι διαλυτά στο νερό είναι γνωστά ως υδρόφιλα αμινοξέα. Είναι—Gly, Ser, Thr, Cys, Tyr, Asp, Asn, Glu, Gin, Lys, Arg, His.

III. Ανάλογα με τις διατροφικές τους απαιτήσεις:

Τα αμινοξέα ταξινομούνται σε δύο ομάδες.

1. Απαραίτητα αμινοξέα:

Είναι αυτά που δεν μπορούν να συντεθούν από τον ανθρώπινο οργανισμό και ως εκ τούτου πρέπει να λαμβάνονται μέσω της διατροφής. Υπάρχουν 10 απαραίτητα αμινοξέα. Μεταξύ αυτών των αμινοξέων, η αργινίνη και η ιστιδίνη είναι γνωστά ως ημι-απαραίτητα αμινοξέα.

2. Μη απαραίτητα αμινοξέα:

Αυτά τα οξέα είναι εκείνα που μπορούν να συντεθούν στο ανθρώπινο σώμα και δεν απαιτούνται στη διατροφή. Αυτά περιλαμβάνουν gly, ala, ser, pro, tyr, cys, asp, asn, glu, gin.

Αντιδράσεις αμινοξέων:

Φυσικοί χαρακτήρες των αμινοξέων:

Τα αμινοξέα έχουν μια όξινη ομάδα (—ομάδα COOH), δηλαδή ένα πρωτόνιο, δότη. Έχουν επίσης μια βασική ομάδα (-NH2 ομάδα), δηλ. ένα πρωτόνιο, δέκτης. Μια ένωση ικανή τόσο να δίνει όσο και να δέχεται πρωτόνια και επομένως μπορεί να δρα είτε ως οξύ είτε ως βάση είναι γνωστή ως αμφοτερικό μόριο. Τα αμινοξέα έχουν τόσο ανιόντα όσο και κατιόντα στο διάλυμα και τέτοιες ενώσεις ονομάζονται ιόντα διπολικού.

2. Ισοηλεκτρικό pH (pH 1 ):

Το pH στο οποίο το θετικό φορτίο στο αμινοξύ (ή οποιοδήποτε άλλο μόριο) είναι ίσο με τα αρνητικά φορτία, είναι γνωστό ως ισοηλεκτρικό pH. Σε αυτό το pH το καθαρό φορτίο θα είναι μηδέν και ως εκ τούτου δεν μετακινείται ούτε στο θετικό (άνοδος) ούτε στο αρνητικό (κάθοδο) ηλεκτρόδιο, όταν υποβάλλεται σε ηλεκτρικό πεδίο. Σε pH 1 όλα τα μόρια υπάρχουν σε μορφή ιόντων διπολικού.

Χημικές ιδιότητες:

1. Αντιδράσεις λόγω αμινομάδας:

Αυτή η δοκιμή αναγνωρίζει ή ανιχνεύει αμινοξέα. Εάν τα αμινοξέα θερμαίνονται με νινυδρίνη, σχηματίζουν μια μωβ μπλε ένωση, η οποία μετράται χρωματομετρικά.

(β) Αντίδραση με νιτρώδες οξύ:

Είναι μια μέθοδος με την οποία μετρώνται τα αμινοξέα ανάλογα με την ποσότητα του αζώτου που απελευθερώνεται.

(γ) Αντίδραση με καρβονυλικές ενώσεις (RCHO):

Η αμινομάδα στα αμινοξέα αντιδρά με ενώσεις καρβονυλίου σχηματίζοντας μια βάση Schiff’s.

(δ) Αντίδραση με αντιδραστήριο Sanger’s:

Τα αμινοξέα αντιδρούν με το αντιδραστήριο Sanger’s, δηλ. 1-φθορο-2, 4-δινιτροβενζόλιο, σχηματίζοντας ένα κίτρινο σύμπλοκο. Αυτό το αντιδραστήριο χρησιμοποιείται για την ανίχνευση του IV-τελικού αμινοξέος στις πρωτεΐνες.

Το αντιδραστήριο Edmann’s είναι ισοθειοκυανικό φαινύλιο, το οποίο χρησιμοποιείται επίσης για την ανίχνευση του Ν-τερματικού αμινοξέος σε μια πρωτεΐνη. Σχηματίζει ένα πορφυρό παράγωγο.

(στ) Αντίδραση με χλωριούχο δανσύλιο:

Το χλωριούχο δανσύλιο, δηλ. το 1-διμεθυλ-αμινο-ναφθαλενο-5-σουλφονυλοχλωρίδιο σχηματίζει ένα φθορίζον παράγωγο του Ν-τερματικού αμινοξέος των πρωτεϊνών. Αυτό είναι ένα ακόμη αντιδραστήριο που είναι διαθέσιμο για την ανίχνευση του Ν-τερματικού αμινοξέος.

(ζ) Συμπύκνωση δύο αμινοξέων για σχηματισμό δικετοπιπεραζίνης:

Δύο αμινοξέα αντιδρούν με αμινομάδες κάθε αμινοξέος και οι καρβοξυλικές ομάδες του άλλου αμινοξέος σχηματίζοντας δικετοπιπεραζίνη.

2. Reaction due to carboxylic:

(a) Reaction with hydrazine:

Hydrazine is used to detect the C-terminal amino acid in proteins. It forms a complex with the amino acid by reacting with the carboxylic group.

3. Reaction due to both amino and carboxylic group:

Due to the presence of both amino (basic) and carboxylic (acid) groups in amino acids, the amino group of one amino acid reacts with the carboxylic group of another amino acid to form a peptide bond.

Polymerization of amino acids in a similar manner gives a polypeptide chain.

The bond linking two amino acids is known as a peptide bond. It is formed due to reaction between an amino group of one amino acid and carboxylic group of another amino acid.

The group forming the peptide bond is known as peptide group. It has a double bond character and hence is very rigid in nature.

Polypeptide or peptide:

A chain made up of two or more amino acids, linked by a peptide bond is known as a polypeptide or just a peptide.

Difference between a peptide and a protein:

A peptide is that which has less than 50 amino acids or whose molecular weight is less than 5000 Daltons. A protein is that which has more than 50 amino acids or whose molecular weight is more than 5000 Daltons. This differentiation is based upon the immunolog­ical property of the two units. Peptides are non-immunogenic, whereas proteins are immunogenic.

N-terminal and C-terminal of a protein:

The end of a protein or polypeptide where the amino group is free in known as N-terminal end and that amino acid whose amino group is free is known as N-terminal amino acid. Sanger’s, Edmann’s and Dansyl chloride are the reagents used to determine the N-terminal amino acids.

The end of the protein or polypeptide whose carboxylic group is free is known as C-terminal end and that amino acid whose carboxylic group is free in the protein is known as C-terminal amino acid. Hydrazine is used to detect the C-terminal amino acid. While representing a protein on paper, the N-terminal amino acid is written first (on the left) and the C-terminal amino acid is the last one (written at the right side of the paper).

Peptides of physiological importance:

It is a tripeptide made up of Glu, Cys and Gly. It is found in RBC and other tissues and functions to prevent oxidation of —SH groups of many enzymes.

(σι) Bradykinin and kallidin:

These are small polypeptides containing 9 and 10 amino acids respectively. They are formed by partial hydrolysis of plasma protein due to snake poisoning (venom). They are powerful vasodepressors and inhibitors of heart function. Others are tyrocidin, gramicidin, glucagon, insulin, oxytocin, etc.

The structure of protein can be studied under four different levels of organization, viz., primary, secondary, tertiary and quaternary.


Δες το βίντεο: Αμινοξέα - BCAA - Ό,τι χρειάζεται να ξέρετε! (Νοέμβριος 2022).